Supplemental Text 1
MIQE
Minimum Information for Publication of Quantitative Real-Time PCR Experiments
Information designed according to the MIQE guidelinesas essential (E)is presented Desirable information (D) isattached if it is available
EXPERIMENTAL DESIGN
Definition of experimental and control groups(E)
two experimental “groups”:
i)The S aureus strains at 105 CFU mL-1concentration were inoculated alone or co-inoculated with 106 CFU mL-1 each of LAB in 225 mL portions of tryptic soy broth (TSB, pH = 68, Merck, Germany)at 30 °C under static condition for 24 h
ii)The fresh milk 1,5 % processed cows' milk, (Raw milk of gentle pasteurisation, purchased from a retail outlet in the Czech Republic) at 30 °C under static condition for 24 h
Prior to inoculation, the pre-culture was washed twice with saline solution to remove residual enterotoxins and different metabolic molecules (repeated centrifugation at 12,500 × g for 5 min 4 oC and resuspension in the saline solution)
All experiments were carried out in duplicates
Number within each group(E)
Two strains of S aureus Sa 1612 (sea, seb, sec, sel) dairy strain and MW2 (sea, selk, selq, sec, sel) pathogenic human strain were selected for this study Three lactic acid bacteria: L plantarum CCDM336, S thermophilus CCDM78A and E durans CCDM53
Assay carried out by core lab or investigator's lab?(D)
Assay was carried out byinvestigator’s lab
SAMPLE
Description(E)
Samples were collected during each experiment at five different times during the cell growth - at 0, 6, 12, 18 and 24 hours (Figure 1)
Volume/mass of sample processed(D)
The sample volume was 20 mL for each culture (TSB and milk)
Microdissection or macrodissection (E)
not applied
Processing procedure(E)
Cells were collected by centrifugation at 15000 x g for 15 minutes at 4°C, supernatant was discarded Samples taken from milk were mixed with n-decan and sodium citrate prior the centrifugation according to a protocol published by Rueckert et al. [6]in order to remove lipid fraction After centrifugation the pellet was washed with 1 mL of TE buffer (10 mmol L−1 Tris-HCl, 1 mmol L−1 EDTA, pH 8·0) and samples were stored at -80 °C
If frozen - how and how quickly?(E)
After the centrifugationcell pellets were immediately placed into an ultra-low temperature freezer (-80°C)
If fixed, with what and how quickly? (E)
not applied
Sample storage conditions and duration (especially for FFPE samples)(E)
Samples were stored at -80°C till RNA extraction (maximally for one week)
NUCLEIC ACID EXTRACTION
Procedure and/or instrumentation(E)
Total RNA was extracted using a phenol and chloroform method and then purfication with Qiagen RNEasy mini kit (Qiagen, Germany) as described by Ulve et al [7] with some modification After storage at -80 °C, frozen cell pellets were resuspended in 500 μl of ice-cold a solution composed of Tris EDTA (20 mmol L−1 Tris-HCl, 2 mmol L−1 EDTA, pH 8) buffer and RLT buffer (RNeasy mini kit, Qiagen, Germany) (30/70, v/v – that mean 150 μl Tris-EDTA and 350 μl RLT buffer) before being transferred in a 2-mL microtube containing 0·6 g of acid-washed glass beads (425-600 μm diameter; Sigma Aldrich, USA), 25 μl 20 % of SDS (Ambion, Thermo Fisher Scientific, USA) and 500 μl of acid phenol solution (pH 4·3 ±02; Sigma Aldrich, USA) In addition,10 μl 143 M 2-Mercaptoethanol (Sigma Aldrich, USA) was added per 1 mL RLT buffer and gently mixed The tubes were shaken three times for 1 min at maximum speed in a bead beater (FastPrep-24, USA) with chilling on ice for 2 min between each shaking stepAfter addition of 200 μl chloroform, the samples were vigorously shaken and centrifuged for 20 min at 13 000 g at 4°C The aqueous phase was recovered and one volume of ethanol (70%) was added per volume of aqueous phase Samples were then loaded on an RNeasy® spin column (QIAGEN, Germany) and subsequent steps performed according to the manufacturer’s instructions The RNA was eluted twice using 30 μl of RNase-free water
Name of kit and details of any modifications(E)
Qiagen RNEasy mini kit (Qiagen, Germany)
Same volumes of samples were used (see above)
Details of DNase or RNAse treatment(E)
DNase I Amplification Gradekit (AMPD1, Sigma-Aldrich, USA) was used according to manufacturer’s protocol
Contamination assessment (DNA or RNA)(E)
A level of DNA contamination was determinedbyqPCRs with treated RNAand correspondingcDNA samples (qPCR detected thehu gene - protocols and other details see below)Cq-values were compared- only samples without signalsin the reaction with RNA or with a higher difference than 15 Cqs between RNA and cDNA samples were assessed to be free of DNA contamination
Nucleic acid quantification(E)
RNA concentration was quantified spectrophotometrically using NanoPhotometer™ (Implen GmbH, GER)
Instrument and method(E)
NanoPhotometer™ (Implen GmbH, GER) was used according to manufacturer’s protocol
Purity (A260/A280)(D)
The ratio A260/A280 wasbetween 18 and 21indicating good purityin each sample
Yield(D)
From each sample approx 05-10 μg RNA was extracted (worse yields were usually achieved with samples from earlier growth phases)
RNA integrity method/instrument(E)
RNA integrity was verified by gel electrophoresis
RIN/RQI or Cq of 3' and 5' transcripts(E)
not applied
Inhibition testing (Cq dilutions, spike or other)(E)
Theserial dilution methodwas applied to each sample (following byqPCRdetecting thehugene - qPCR protocols and other details below) No inhibition was observed
REVERSE TRANSCRIPTION
Complete reaction conditions(E)
M-MLV Reverse Transcriptase RNase H- kit (Solis BioDyne, Estonia) was used according to manufacturer’s recommendations RT reactions were prepared mixing reaction volume 50 µl: In a sterile microcentrifuge tube, was added RNA (4 µl) and primer(s) mix (primer (dT18) 20 pmol/ µl 3,47 µl and primer hexamer 20 pmol/ µl 2,09 µl) in a total volume of 15 µl NFW Heated the tube at 70°C for 10 minutes, then was placed in ice and tube was spin for a few seconds Subsequently, the tube was added 23 µl NFW, 1 µl 20 mM dNTP mix, 10 µl 5x RT Reaction buffer 1 (with MgCl2 and DTT) and 1 µl M-MLV Reverse Transcriptase RNase H- (200 U/µl) enzyme Reaction components were mixed gently and incubated at 37°C for 90 min and 95 °C for 5 min in a thermal cycler
Amount of RNA and reaction volume(E)
4 μl RNA (5 ng/μg RNA), 50 μl reaction volume
Priming oligonucleotide (if using GSP) and concentration(E)
Oligo(dT18) and hexamer priming (mix of oligonucleotides was with concentration - primer (dT18) 178,5 ug (33 nmol) and primer hexamer 66,7 ug (37,2 nmol))
Reverse transcriptase and concentration(E)
M-MLV Reverse Transcriptase RNase H- (200 U/µl)
Temperature and time(E)
70 °C for 5 min, 37°C for 90 min and 95 °C for 5 min
Cqs with and without reverse transcription (D)
Cqs with reverse transcription < 40; Cqs without reverse transcription - undetected ordifference higher difference than 15 Cqs between samples with and without reverse transcription
Storage conditions of cDNA(D)
In a freezer at -20 °C
qPCR TARGET INFORMATION
Gene symbol(E)
Enterotoxin genes - sea, sec, sel
Normalization genes -gyrB, hu, recA, rpoB, (above and below designed just like hu)
Regulation genes - sarA, saeS, codY, srrA, rot, hld, agrA, sigB
Sequence accession number(E)
sea 1004003, sec 1002871, sel1002872, gyrB1004400, hu1003474, recA1003280, rpoB1002608, sarA1002691, saeS1002778, codY1003250, srrA1003558, rot1003817, hld1004072, agrA1004076, sigB1004104
Amplicon length(E)
sea 106 bp, sec 101 bp, sel101 bp, gyrB 121 bp, hu 125 bp, recA 121 bp, rpoB 121 bp, sarA 124 bp, saeS 104 bp, codY 114 bp, srrA 105 bp, rot107 bp, hld90 bp, agrA127 bp, sigB145 bp
In silico specificity screen (BLAST, etc)(E)
not applied
Location of each primer by exon or intron (if applicable)(E)
not applied, prokaryote
What splice variants are targeted?(E)
not applied, prokaryote
qPCR OLIGONUCLEOTIDES
Primer sequences(E)
seaF:AAAGATTTGCGAAAAAAGTCTGAATT,
R: CGTGACTCTCTTTATTTTCAGTTTTAGC
secF:GGCAATACTTTTTGGTATGATATGATG,
R:TTAGAATCAACCGTTTTATTGTCGTTG
selF:GGTTACCGCACAAGAAATAGATG,
R:TGCCGTATTCTTTACCTTTACCA
gyrBF:CCAGGTAAATTAGCCGATTGC,
R:AAATCGCCTGCGTTCTAGAG
huF:TTTACGTGCAGCACGTTCAC,
R:AAAAAGAAGCTGGTTCAGCAGTAG
recAF:GGGAGACACTCACGTTGGTTTAC,
R:AACTTTTTCACGAATTTGGTTGATG
rpoBF:GCGAACATGCAACGTCAAG,
R:GACCTCTGTGCTTAGCTGTAATAGC
saeSF: TCAATATTGCAACCATATGAGCA,
R:AGTGGCGTTCGATATTGATAAAA
codYF: ATGGAAATCTTACGTGAGAAGCA,
R:ATGTTCAATCGCTTCTTTTTCAG
srrAF: ATCTTTTGAAATCCATGAAGCAA,
R:TCCATTTCAGGCAACATTAAATC
rotF: ATTGGGAGATGTTTAGCATGAAA,
R:TTCAATCTCGCTGAAAATTGAGT
hldF: TAAGGAAGGAGTGATTTCAATGG,
R:GTGAATTTGTTCACTGTGTCGAT
agrAF: CCTCGCAACTGATAATCCTTATG,
R:ACGAATTTCACTGCCTAATTTGA
sigBF: TTCACCTGAGCAAATTAACCAAT,
R: ATCTTCGTGATGTGATTGTCCTT
All sequences were adapted from the literature [1, 2, 3, 4, 5]
Location and identity of any modifications(E)
not applied
qPCR PROTOCOL
Complete reaction conditions (E)
Reaction mixtures consisted of 3 μl of 5x HOT FIREPol EvaGreen qPCR Supermix (Solis BioDyne, Estonia), 0375 μl of each 10 μM primer (250 nM final), 75 μl of nuclease free water and 375 μl cDNA (1:5 dilution) - final volume = 12 μl
The thermo cycling program consisted of one hold at 95 °C for 12 min, followed by 40 cycles of 15 s at 95°C, 30 s at 63°C for annealing, then extension for 30 s at 72°C The melting curve analysis(60°C→95°C) was performed after each run
Reaction volume and amount of cDNA/DNA(E)
The total reaction volume was 15 μl, volume of cDNA was 375 μl (5-times diluted cDNA after RT)
Primer, (probe), Mg2+ and dNTP concentrations(E)
250 nM of each primer, Mg2+ and dNTPs were parts of commercial5x HOT FIREPol EvaGreen qPCR Supermix(Solis BioDyne, Estonia), concentration unknown
Polymerase identity and concentration(E)
HOT FIREPol®DNA polymerase- part of commercial5x HOT FIREPol EvaGreen qPCR Supermix (Solis BioDyne, Estonia), concentration unknown
Buffer/kit identity and manufacturer(E)
5x HOT FIREPol® EvaGreen® qPCR SupermixMaster Mix (Solis BioDyne, Estonia)
Additives (SYBR Green I, DMSO, etc)(E)
not applied
Manufacturer of plates/tubes and catalog number(D)
96 x 02mL Plate - RP,LF,NON Sk,cutable,96 well plate(02mL) (catalog number B50501, BIOplastics, Netherlands)
Complete thermocycling parameters(E)
95°C 10 min, 95 °C 15 s, 63 °C 30 s and 72 °C 30 s for 40 cycles, melting curve 60°C to 95°C
Reaction setup (manual/robotic) (D)
manual
Manufacturer of qPCR instrument(E)
7500 Real-Time PCR System (Life Technologies, USA)
qPCR VALIDATION
Specificity (gel, sequence, melt, or digest)(E)
Melting curve analyses
For Eva Green I, Cq of the NTC(E)
No signal in NTCs or Cq > 37 (hu)
Calibration curves with slope and y-intercept(E)
sea (slope:-3399; Y-inter:19661)
sec (slope:-3165; Y-inter:17979)
sel(slope:-3386; Y-inter:17515)
gyrB (slope:-3176; Y-inter:17193)
hu (slope:-3347; Y-inter:18504)
recA (slope:-3137; Y-inter:18096)
rpoB (slope:-324; Y-inter:17147)
sarA(slope:-3146; Y-inter:17944)
saeS(slope:-3251; Y-inter:17368)
codY(slope:-3201; Y-inter:19093)
srrA(slope:-3161; Y-inter:19338)
rot(slope:-3111; Y-inter:18151)
hld(slope:-325; Y-inter:17766)
agrA(slope:-3105; Y-inter:17466)
sigB(slope:-3462; Y-inter:17441)
PCR efficiency calculated from slope(E)
sea(E = 1010), sec(E = 1070), sel(E = 974), gyrB (E = 1065), hu(E = 990), recA (E = 1083), rpoB (E = 1036), sarA(E = 1079), saeS(E = 1030), codY(E = 1053), srrA(E = 1072), rot(E = 1096), hld(E = 1031), agrA(E = 1100), sigB(E = 945)
r2 of calibration curve(E)
sea(R2 = 0998), sec(R2 = 0998), sel(R2 = 0999), gyrB (R2 = 0999), hu (R2 = 0999), recA (R2 = 0999), rpoB (R2 = 0999), sarA(R2 = 0998), saeS(R2 = 0999), codY(R2 = 0999), srrA(R2 = 0998), rot(R2 = 0998), hld(R2 = 1000), agrA(R2 = 0999), sigB(R2 = 0998)
Linear dynamic range(E)
Five-pointsten-fold serial dilution wastested (designed 105-101 copies per mL, the real copy-number was unknown) Cq values achievedduring experimentswere in this range (approx 15-34 Cq) All reactions havea potential to cover a wider range of Cq-values
Cq variation at limit of detection (E)
not determined
Evidence for limit of detection(E)
not determined
If multiplex, efficiency and LOD of each assay (E)
not applied
DATA ANALYSIS
qPCR analysis program (source, version)(E)
7500 Software(Life Technologies, USA, version 205)
Method of Cq determination(E)
2nd max derivate
Outlier identification and disposition(E)
not determined
Results of NTCs(E)
no signal in NTCs or Cq > 37 (recA, pta, 16S rRNA)
Justification of number and choice of reference genes(E)
Description of normalization method(E)
Geometric averaging of multiple internal reference genes method (Vandesompele et al. [8]
Number and stage (RT or qPCR) of technical replicates(E)
Distribution of technical replicates: technical triplicates; 1 RNA extraction; 1 RT-PCR; 1 qPCRs
Repeatability (intra-assay variation)(E)
not determined
Statistical methods for results significance(E)
t-test considering the P-value lower than 005
Software (source, version)(E)
GraphPad InStat (GraphPad Software, USA, version 310)
References
- Cretenet M, Nouaille S, Thouin J, Rault L, Stenz L, Francois P, Hennekinne JA, Piot M, Maillard MB, Fauquant J, Loubiere P, Le Loir Y, Even S (2011b) Staphylococcus aureus virulence and metabolism are dramatically affected by Lactococcus lactis in cheese matrix Environ Microbiol Rep 3:340-351
- Duquenne M, Fleurot I, Aigle M, Darrigo C, Borezee-Durant E, Derzelle S, Bouix M, Deperrois-Lafarge V, Delacroix-Buchet A (2010) Tool for Quantification of Staphylococcal Enterotoxin Gene Expression in Cheese Appl Environ Microbiol 76:1367-1374
- Even S, Charlier C, Nouaille S, Zakour NLB, Cretenet M, Cousin FJ, Gautier M, Cocaign-Bousquet M, Loubiere P, Le Loir Y (2009) Staphylococcus aureus Virulence Expression Is Impaired by Lactococcus lactis in Mixed Cultures Appl Environ Microbiol 75:4459-4472
- Letertre, C, Perelle S, Dilasser F, Fach P (2003) A strategy based on 5' nuclease multiplex PCR to detect enterotoxin genes sea to sej of Staphylococcusaureus. Molecular and Cellular Probes 17:227-235
- Martineau F, Picard FJ, Roy PH, Ouellete M, Bergeron MG (1998) Species-specific and ubiquitous-DNA-based assays for rapid identification of Staphylococcus aureus. Journal of Clinical Microbiology 36:618-623
- Rueckert A, Ronimus RS, Morgan HW (2005) Development of a rapid detection and enumeration method for thermophilic bacilli in milk powders. Journal of Microbiological Methods 60:155-167
- Ulve VM, Monnet C, Valence F, Fauquant J, Falentin H, Lortal S (2008) RNA extraction from cheese for analysis of in situ gene expression of Lactococcus lactis J Appl Microbiol 105:1327-1333
- Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes Genome Biol 3
1