Euphytica
Physiological and metabolomic analysis of a knockout mutantsuggests a critical role of MtP5CS3 gene in osmotic stress tolerance of Medicago truncatula
Minh Luan Nguyena, Goon-Bo Kima, Sun-Hee Hyunb, Seok-Young Leeb,
Chae-Young Leec, Hong-Kyu Choic, Hyung-Kyoon Choib, and Young-Woo Nama*
aDepartment of Life Science, Sogang University, Seoul 121-742, Korea
bCollege of Pharmacy, Chung-Ang University, Seoul 156-756, Korea
cDepartment of Genetic Engineering, College of Natural Resources and Life Science, Dong-A University,
Busan604-714, Korea
*Correspondence to: (Y.-W. Nam).
Tel.: +82-2-705-8792; fax.: +82-2-704-3601.
______
Supplementary Material
Supplementary Table S1. Oligonucleotide primers used for quantitative real-time PCR and RNA gel blot analyses.
Supplementary Table S2.Root growth of the Mtp5cs3 mutantsunder salinity and proline supplementation.
Supplementary Table S3.Metabolic profile of M. truncatula plants under drought stress.
Supplementary Figure S1.Genomic structure, genotyping, and phenotypic features of the MtP5CS3gene and mutant.
Supplementary Figure S2. Effects of salt and drought stresses on P5CS enzyme activity.
Supplementary Figure S3.Responses of the Mtp5cs3 mutant to low temperature.
Supplementary Figure S4. PCA showing metabolite accumulation in drought-treated M. truncatula seedlings.
Supplementary Figure S5. Relative metabolite accumulation in the wild type and Mtp5cs3plants under drought.
Supplementary Figure S6. Effects of salinity on symbiotic nitrogen fixation in the Mtp5cs3 mutant.
Supplementary References
Supplementary Tables
Supplementary Table S1.Oligonucleotide primers used for quantitative real-time PCR and RNA gel blot analyses.
Geneforward (5'-3')Reverse (5'-3')
MtP5CS1TTCTCCAAGGACAGCGTATTGGCAGTCCCTAGCGGCAACAGCCA
MtP5CS2GTGCTGCTTATTCAGGCACACGGTCCACAAGTGAGCATCCTT
MtP5CS3AATTTGCCACCATCACCAAACCAGCTGTTCCAACCTTAACAAT
MtP5CS3aCTCGGGTCTCTCCGTCACTCACCAGCTGTTCCAACCTTGACGA
MtCorA1TCCACTGATGCCAAAAAGGAAGTCAGATTCAGCAGCACCGTGAC
DRGAGCGAGGAGGAAGTTGATGGTGGTGCTGGTGGAGTTGTTA
-ACTIN2GACTCAGTACTTTCCAGCAGATGTGCAGATTATACCCTCGGATCTCACC
Supplementary Table S2.Root growth of the Mtp5cs3 mutantsunder salinity and proline supplementation.Lateral root numbers and lengths of the wild type (WT) and Mtp5cs3 mutant (p5cs3) are shown in the absence or presence of NaCl and proline.
WTp5cs3WT +p5cs3+
Pro (10 mM)Pro (10 mM)
Lateral root numberControl3.25 ± 1.263.14 ± 1.293.60 ± 1.312.60 ± 1.43
per plantNaCl(75 mM)1.35 ± 0.890.55 ± 0.521.83 ± 1.041.41 ± 0.98
Lateral root lengthControl74.39 ± 28.0069.43 ± 25.9166.50 ± 16.1463.50 ± 17.90
(mm/plant)NaCl(75 mM)10.85 ± 3.84 3.91 ± 2.74 15.33 ± 7.32 20.97 ± 14.78
1
Supplementary Table S3.Metabolic profile of M. truncatula plants under drought stress. Root (R) and shoot (Sh) samples harvested from the wild type (W) and mutant (p) untreated (Control) or drought-treated (Dr) were analyzed by gas chromatography and mass spectrometry. Relative values obtained by dividing the peak area of each metabolite by that of the internal standard are shown in mean ± standard deviation calculated from three biological replicates. Different letters in a given row (a – d) indicate significant difference.
Compound / Relative sample intensityControl_W_R / Control_W_Sh / Control_p_R / Control_p_Sh / Dr_W_R / Dr_W_Sh / Dr_p_R / Dr_p_Sh
Amino acid
Alanine / 0.045±0.008c / 0.016±0.004a / 0.075±0.002d / 0.021±0.004a / 0.035±0.004b / 0.023±0.002a / 0.051±0.001c / 0.023±0.011a
Asparagine / 2.769±1.417 / 1.637±0.429 / 1.151±0.461 / 1.776±1.335 / 2.659±0.181 / 5.564±0.477 / 3.729±0.150 / 4.853±2.541
Aspartic acid / 0.253±0.079a / 0.892±0.217bc / 0.210±0.060a / 0.891±0.122bc / 0.645±0.014b / 0.725±0.023b / 1.064±0.005c / 0.871±0.105bc
Glutamic acid / 0.396±0.132a / 1.083±0.148b / 0.304±0.075a / 1.118±0.048b / 0.318±0.011a / 1.026±0.063b / 0.533±0.013a / 1.011±0.106b
Glutamine / 0.083±0.036c / 0.024±0.004a / 0.058±0.006abc / 0.020±0.017a / 0.037±0.001ab / 0.041±0.007abc / 0.079±0.004bc / 0.038±0.018abc
Glycine / 0.394±0.050a / 0.033±0.029b / 0.371±0.079a / 0.033±0.029b / 0.228±0.004c / 0.102±0.009b / 0.212±0.003c / 0.071±0.025b
Isoleucine / 0.364±0.184a / 0.167±0.059a / 0.370±0.116a / 0.219±0.038a / 1.133±0.032b / 1.528±0.037bc / 1.722±0.084c / 1.330±0.456bc
Leucine / ND / ND / ND / ND / ND / ND / ND / 0.299±0.261
Lysine / 0.121±0.036bc / 0.037±0.032a / 0.159±0.044c / 0.077±0.033ab / 0.078±0.004ab / 0.062±0.007ab / 0.095±0.001abc / 0.036±0.031a
Methionine / 0.122±0.006a / 0.029±0.005b / 0.121±0.015a / 0.031±0.033bc / 0.094±0.010ac / 0.083±0.037abc / 0.124±0.001a / 0.042±0.037bc
Norleucine / 0.610±0.398abc / 0.189±0.063a / 0.660±0.181abc / 0.267±0.063ab / 0.893±0.050bcd / 1.386±0.314de / 1.588±0.076e / 1.025±0.314cde
Phenylalanine / 0.068±0.031a / 0.076±0.030a / 0.062±0.020a / 0.066±0.006a / 0.109±0.042ab / 0.396±0.030c / 0.106±0.042ab / 0.317±0.199bc
Proline / 1.931±1.349ab / 0.324±0.204ab / 0.647±0.247ab / 0.158±0.030a / 32.913±0.517d / 23.869±2.926c / 21.992±0.548c / 6.790±5.739b
Serine / 0.893±0.234ab / 1.029±0.187b / 0.818±0.160ab / 0.558±0.055a / 1.200±0.021b / 1.250±0.084b / 1.650±0.017b / 1.090±0.258b
Threonine / 0.250±0.073a / 0.251±0.031a / 0.258±0.111ab / 0.226±0.038a / 0.476±0.011c / 0.448±0.025c / 0.569±0.016c / 0.441±0.115bc
Tryptophan / 0.230±0.064abc / 0.049±0.046a / 0.312±0.053bc / 0.082±0.039ab / 0.273±0.016abc / 0.383±0.052c / 0.374±0.039c / 0.366±0.194c
Valine / 0.495±0.177a / 0.235±0.066a / 0.427±0.111a / 0.290±0.072a / 1.830±0.117b / 2.334±0.146b / 2.483±0.080b / 1.760±0.966b
Other N-compound
Putrescine / 0.207±0.034a / 0.023±0.020b / 0.325±0.099c / 0.025±0.022b / 0.015±0.001b / 0.036±0.002b / 0.027±0.002b / 0.035±0.008b
1H-indole / 1.406±0.743cd / 1.373±1.374a / 3.158±3.927e / 1.021±0.743ab / 1.303±0.831bc / 3.183±0.935ab / 1.478±1.286d / 1.963±1.367ab
Urea / 0.064±0.018ab / 0.111±0.134ab / 0.185±0.037b / 0.037±0.027a / 0.054±0.010ab / 0.088±0.002ab / 0.040±0.010a / 0.054±0.022ab
Uric acid / 0.050±0.020a / 0.005±0.005b / 0.046±0.032a / 0.006±0.005b / NDb / NDb / NDb / NDb
Inorganic acid
Phosphoric acid / 2.583±1.441a / 1.049±0.568ab / 1.837±0.117ab / 1.373±0.609ab / 1.836±0.280ab / 1.007±0.319ab / 1.543±0.291ab / 0.676±0.289b
Organic acid
Carboxylic acid / ND / ND / ND / ND / 0.012±0.011a / 0.075±0.012b / 0.005±0.008a / 0.051±0.046ab
Citric acid / 0.966±0.088 / 2.027±0.090 / 1.404±1.419 / 1.901±0.511 / 1.417±0.032 / 1.293±0.160 / 1.411±0.059 / 1.104±0.264
Fumaric acid / 0.019±0.004ab / 0.040±0.012a / 0.034±0.016ab / 0.035±0.005ab / 0.022±0.001ab / 0.020±0.003ab / 0.013±0.012b / 0.013±0.012b
Galactonic acid / 0.018±0.031a / 0.215±0.034cd / 0.051±0.005ab / 0.194±0.013c / 0.089±0.002b / 0.220±0.022cd / 0.085±0.004b / 0.249±0.012d
Glucaric acid / 0.004±0.007a / 0.044±0.012b / 0.005±0.008a / 0.022±0.025ab / 0.025±0.001ab / 0.022±0.004ab / 0.025±0.003ab / 0.018±0.016ab
Gluconic acid / 0.020±0.026a / 0.045±0.014ab / 0.002±0.004a / 0.029±0.026ab / 0.187±0.015c / 0.075±0.012b / 0.167±0.014c / 0.032±0.028ab
Glucuronic acid / NDa / 0.126±0.042ab / 0.094±0.163ab / 0.144±0.030ab / 0.239±0.013b / 0.134±0.011ab / 0.232±0.019b / 0.135±0.033ab
Glyceric acid / 0.026±0.002 / 0.032±0.011 / 0.028±0.014 / 0.019±0.003 / 0.028±0.001 / 0.038±0.002 / 0.028±0.001 / 0.038±0.010
Malic acid / 1.170±0.255a / 9.588±1.210b / 2.766±2.249a / 8.911±0.640b / 2.504±0.014a / 9.135±0.195b / 2.850±0.192a / 6.990±2.751b
Malonate / NDa / 0.288±0.069a / NDa / 0.391±0.277a / NDa / 0.331±0.161a / NDa / 1.667±1.123b
Succinic acid / 0.526±0.159b / 0.228±0.049ab / 0.490±0.291b / 0.218±0.070ab / 0.081±0.004a / 0.310±0.015ab / 0.107±0.001a / 0.334±0.093ab
Threonic acid / 0.059±0.009a / 0.412±0.225b / 0.065±0.032a / 0.334±0.126b / 0.059±0.003a / 0.300±0.020ab / 0.058±0.002a / 0.352±0.047b
Fatty acid
Butanoic acid / 2.386±0.510c / 0.043±0.014a / 2.697±0.325c / 0.027±0.004a / 0.678±0.015b / 0.241±0.025ab / 0.783±0.035b / 0.183±0.136ab
Lauric acid / 0.006±0.006 / 0.011±0.001 / 0.007±0.007 / 0.011±0.003 / 0.007±0.000 / 0.011±0.001 / 0.010±0.001 / 0.012±0.002
Linolenic acid / 0.048±0.005b / 0.037±0.009ab / 0.042±0.011ab / 0.071±0.042b / NDab / 0.037±0.003a / NDab / 0.039±0.015a
Palmitic acid / 0.846±0.206 / 0.724±0.072 / 0.960±0.058 / 0.763±0.048 / 0.709±0.274 / 0.698±0.018 / 0.579±0.183 / 0.979±0.309
Ribonic acid / 0.006±0.005a / 0.097±0.011b / 0.005±0.004a / 0.095±0.003b / 0.015±0.001a / 0.107±0.013b / 0.015±0.000a / 0.106±0.012b
Stearic acid / 0.112±0.038 / 0.060±0.007 / 0.129±0.024 / 0.053±0.008 / 0.081±0.031 / 0.068±0.024 / 3.462±5.884 / 0.082±0.033
Sugar
Arabinose / ND / 0.014±0.003 / 0.006±0.010 / 0.007±0.006 / 0.010±0.003 / 0.023±0.006 / 0.009±0.004 / 0.016±0.006
Fructose / 0.037±0.008 / 0.013±0.023 / 0.020±0.021 / 0.012±0.021 / 0.022±0.007 / 0.017±0.014 / 0.024±0.009 / 0.018±0.016
Galactopyranoside / ND / 0.060±0.005 / ND / 0.058±0.007 / ND / 0.057±0.006 / ND / 0.059±0.004
Galactose / 1.899±0.776a / 4.438±1.687ab / 2.371±1.079a / 4.768±2.543ab / 2.754±0.133a / 6.561±0.508b / 3.815±0.564ab / 5.356±1.201ab
Glucopyranoside / 0.493±0.854a / 0.009±0.009a / 0.002±0.005a / NDa / 11.868±10.441b / 0.018±0.007a / 2.393±2.107ab / 0.008±0.007a
Glucose / 1.147±0.434a / 3.240±1.191abc / 1.591±0.777ab / 3.014±1.319abc / 1.872±0.115ab / 4.457±0.519c / 2.318±0.155abc / 3.511±0.833bc
Hexose / 0.085±0.009a / 0.372±0.113b / 0.070±0.012a / 0.335±0.033b / ND / 0.199±0.020a / ND / 0.192±0.059a
Maltose / ND / ND / ND / 0.023±0.020 / ND / 0.009±0.016 / ND / 0.013±0.022
Mannopyranoside / ND / 0.145±0.025 / ND / 0.139±0.024 / ND / 0.109±0.014 / ND / 0.096±0.039
Mannose / 0.275±0.040 / 0.052±0.053 / 0.258±0.066 / 1.663±2.863 / 0.017±0.015 / 0.879±0.066 / 0.052±0.013 / 0.654±0.568
Melibiose / ND / 0.063±0.022 / 0.013±0.022 / 0.024±0.042 / 0.036±0.004 / 0.013±0.022 / ND / 0.046±0.043
Ribose / 0.069±0.013ab / 0.048±0.010a / 0.094±0.018b / 0.064±0.006a / 0.040±0.004a / 0.042±0.007a / 0.059±0.009a / 0.050±0.012a
Sorbose / 0.052±0.022a / 0.060±0.021a / 0.034±0.037a / 0.332±0.521a / 0.101±0.008a / 1.772±0.290b / 0.086±0.003a / 0.855±0.756ab
Alcohol
Arabitol / ND / 0.153±0.011 / ND / 0.170±0.021 / ND / 0.148±0.016 / ND / 0.146±0.024
Glycerol / ND / ND / ND / 0.080±0.139 / 0.159±0.008 / 0.141±0.011 / 0.220±0.027 / 0.136±0.118
Inositol / 0.561±0.074a / 2.674±0.717d / 0.773±0.076a / 2.973±0.367d / 0.745±0.007a / 1.633±0.118bc / 0.943±0.028ab / 1.827±0.059c
Mannitol / 0.024±0.042ab / 0.005±0.009a / 0.002±0.004a / 0.009±0.008a / 0.032±0.009ab / 0.041±0.005ab / 0.058±0.006b / 0.041±0.002ab
Ribitol / NDa / 0.030±0.014ab / 0.003±0.006a / 0.016±0.004ab / 0.011±0.020ab / 0.028±0.020ab / 0.051±0.002b / 0.027±0.031ab
ND: not detected
1
Supplementary Figure Legends
Supplementary Figure S1.Genomic structure, genotyping, and phenotypic features of the MtP5CS3gene and mutant.(A) Schematic representation of the Mtp5cs3 gene where Tnt1 (▼) is inserted in the line NF4970. Numbered arrows indicate primers used for PCR-based genotyping: primers 1 and 3 for amplifying a 159-bp DNA fragment encompassing the wild-type exon 1, and primers 2 and 3 for amplifying a mutant-specific 124-bp fragment. Exon 1a is an alternative coding region of the splice variant,MtP5CS3a. (B)Screening of the R1 individuals of Mtp5cs3. Genomic DNA isolated from each plant was used as template for PCR amplification of the wild type (W) or mutant (T)-specific fragment. Genomic DNAs from A17 and R108were used as controls. M denotes molecular size standards.(C)Time course of fresh weight changes of the whole plants of the wild type (WT) and mutant (p5cs3). (D)Free proline contentsin roots (R), shoots (Sh), and mature seeds. (E)Dry weights of 10 fruits and 100 seeds. Shown in the inset are representative fruits of the wildtype (top) andmutant (bottom). Thin bars indicate standard errors.
Supplementary Figure S2. Effects of salt and drought stresses on P5CS enzyme activity. Four-week-old M. truncatulawildtype and Mtp5cs3mutant plantswere treated with 150 mM NaCl for 1, 8, and 16 d, or kept unwatered for 4 d, and samples were subjected to P5CS enzyme assay. Asterisks denote statistical significance (*, P0.05; **, P0.01; and***,P0.001).
Supplementary Figure S3.Responses of the Mtp5cs3 mutant to low temperature. (A)Fresh weightsof the wild type (WT) and mutant (p3) plants (R, roots; Sh, shoots) grown at 4°C for 3, 6, and 11 d. Control plants (control) were grown at 22°C for 11 d. (B)Free proline contents determined after incubation at 4°Cfor 3, 6, and 11 d. (C)Electrolyte leakage under freezing temperature. Plants with or without preliminary cold acclimation (4°C for 7 d) were transferred to a freezing chamber at the designated temperatures. After 10 h, freezing damage was estimated by measuring electrolyte leakage from the leaves. (D) Plants recovered from freezing treatment. Plants treated as in (C) were transferred to 4°C, incubated for 1 d, and subsequently transferred to the greenhouse for 12-d recovery. Asterisks denote statistical significance (*, P < 0.05; **, P0.01; and ***, P < 0.001).
Supplementary Figure S4. PCA showing metabolite accumulation in drought-treated M. truncatula seedlings. Four-week-old wild type and Mtp5cs3mutant plants were treated with or without drought for 5 d and roots and shoots that were separately harvested were subjected to GC-MS. (A) PCA of drought-treated wild type and mutant roots. (B) PCA of drought-treated wild type and mutant shoots. ‘W’, wild type; ‘p’, mutant; ‘R’; root; ‘Sh’, shoot.
Supplementary Figure S5.Relative metabolite accumulation in the wild type and Mtp5cs3 plants under drought. Logarithmic ratios of the intensities between drought-treated versus untreated root and shoot samples are plotted for each metabolite. All 58 metabolites that were detected by GC-MS are shown in 7 representative groups: (1) amino acids, (2) other N-compounds, (3) inorganic acids, (4) organic acids, (5) fatty acids, (6) sugars, and (7) alcohols. In each group, metabolites are placed hierarchically from higher (top) to lower (bottom) GC-MS intensities. An asterisk (*) indicates metabolites with undetected GC-MS intensities (ND), to which a value of 0.001 was arbitrarily assigned for comparison.
Supplementary Figure S6.Effects of salinity on symbiotic nitrogen fixation in the Mtp5cs3 mutant.(A) Phenotypes of aeroponically grown, two week-old seedlings of the wild type (WT) and Mtp5cs3(p5cs3) mutant inoculated with S. meliloti strain 2011 that carriedthe pXLGD4 plasmid. At 3 weeks after inoculation, the plants with mature nodules were subjected to salt stress by adding 50 mM NaCl in the nutrient solution. After incubation for 96 h, the plants were harvested and photographed.(B) Typical nodules that formed on the roots of the two genotypes at harvest. To visualize rhizobia, nodules were stained with X-gal. (C) Nitrogen fixing ability of the nodules harvested from the two genotypes as determined by acetylene assay. Nitrogenase activity was calculated as a rate of conversion of acetylene (C2H2) to ethylene (Kim and Nam 2013).
Supplementary Figure S1
Supplementary Figure S2
Supplementary Figure S3
Supplementary Figure S4
Supplementary Figure S5
Supplementary Figure S6
Supplementary References
Kim GB, Nam YW (2013) A novel 1-pyrroline-5-carboxylate synthetase gene of Medicago truncatula plays a predominant role in stress-induced proline accumulation during symbiotic nitrogen fixation. J Plant Physiol 170:291–302.
1