Membrane Stresses Induced by Endogenous Free Fatty Acid Overproduction in Escherichia Coli

Membrane Stresses Induced by Endogenous Free Fatty Acid Overproduction in Escherichia coli

Supplementary Material

INDEX:

Table S1: Additional plasmids

Table S2: Oligonucleotide primers

Table S3: Viable cell counts from cultures exposed to exogenously added lauric acid

Table S4: Differentially expressed proteins in shake flask cultures

Table S5: Differentially expressed proteins in fermentor cultures

Table S6: Viable cell counts (CFU ml-1) of strains overexpressing phage shock proteins, MarA, Rob, and SoxS

Figure S1: LC/MS-MS analysis of BTE and BTE-H204A expression in EZ-glucose

Figure S2: Forward scatter and green fluorescence histograms of SYTOX Green stained cells sampled from cultures exposed to exogenously added lauric acid

Figure S3: Growth curves and RNA and protein sampling points of fermentor cultures

Figure S4: Fatty acid titers and unsaturated fatty acid content of fermentor cultures

Figure S5: Fatty acid titers of strains harboring plasmids for overexpression of phage shock proteins, MarA, Rob, and SoxS

2 | Page

Supplementary Material Lennen et al., 2011

Table S1: Additional plasmids used in this study.

Strain/plasmid Relevant genotype/property a Source or reference

Plasmids

pBAD18 PBAD promoter, pBR322 origin, AmpR 32

pBAD18-MarA pBAD18 carrying marA under PBAD control, AmpR This report

pBAD18-Rob pBAD18 carrying rob under PBAD control, AmpR This report

pBAD18-SoxS pBAD18 carrying soxS under PBAD control, AmpR This report

pBAD18-Psp pBAD18 carrying pspABCDE under PBAD control, AmpR This report

aAbbreviations: Amp, ampicillin.

Table S2: Oligonucleotide primers used in this study.

Primer namea Sequence (5' to 3')b

rrs_qPCR_fwd AATGTTGGGTTAAGTCCCGCAACG

rrs_qPCR_rev GACTTGACGTCATCCCCACC

pspD_qPCR_fwd CTGGGCGATAAAATCAGTTGCTCG

pspD_qPCR_rev ACGCTGTGCCAGTTTATTAGCAGC

fabA_qPCR_fwd CACTTTATTGGCGATCCGGTTATG

fabA_qPCR_rev CTTTACCTTCGCCGCCCAGC

inaA_qPCR_fwd CAGTATCGCCTTATTCTGACGAAG

inaA_qPCR_rev AGCCATGCTGACGATTAATGCTATG

marA_colPCR_fwd CGGCGCGGCAATATGTGAAC

marA_colPCR_rev CAACTGGCTGCGTGGTTTGTTC

soxS_colPCR_fwd CGTTTCGCCACTTCGCCG

soxS_colPCR_rev GCGTCGAAACTGAGGAGCAG

pspF_colPCR_fwd CATGCCAGGATGAGTTAGCG

pspF_colPCR_rev CCGCATCCGGCAAGTTGTA

marA_fwd GGGTCTAGAAGGAGGATTATAAAATGTCCAGACGCAATACT

GACG

marA_rev GGCAAGCTTCTAGCTGTTGTAATGATTTAATGGATG

rob_fwdc GGGTCTAGAAGGAGGATTATAAAATGGATCAGGCCGGCATT

ATTCG

rob_revc CGGAAGCTTAACGACGGATCGGAATCAGCAG

soxS_fwd GGGTCTAGAAGGAGGATTATAAAATGTCCCATCAGAAAATT

ATTCAGGATC

soxS_rev GGGAAGCTTACAGGCGGTGGCGATAATC

pspABCDE_fwd GGGGAGCTCAGGACAACATTATGGGTATTTTTTCTCG

pspABCDE_rev GGGCCCGGGTTAACCTTTGACCTTCGGCATTGCG

a Primers containing 'qPCR' in the name were used for amplification of cDNA in quantitative PCR reactions.

Primers containing 'colPCR' were used colony PCR verification of chromosomal gene insertions and deletions.

Primers containing restriction sites were used for amplification of insertions for cloning.

b Restriction sites are underlined

c These primers were also used for colony PCR verification of the rob::kan insertion

Table S3: Viable cell counts (CFU mL-1) from cultures of RL08 and RL08/pTrc99A grown in shake flasks containing EZ rich defined medium supplemented with 0.2% glucose at 4.5 hours (late exponential phase) and 10 hours growth (mid-stationary phase). At an OD600 of approximately 0.2, lauric acid was added to a final concentration of 0.5 g L-1 from an ethanol stock. An equivalent volume of ethanol (corresponding to 1% (v/v)) was added to negative control cultures.

Viable cell counts (CFU mL-1)

Strain Condition transition mid-stationary

RL08 Ethanol (3.76 ± 0.96) ´109 (5.23 ± 1.36) ´109

RL08/pTrc99A Ethanol (3.22 ± 0.08) ´109 (6.03 ± 0.64) ´109

RL08 Lauric acid (2.99 ± 0.09) ´109 (5.6 ± 0.5 ) ´109

RL08/pTrc99A Lauric acid (2.24 ± 0.31) ´109 (4.2 ± 0.2 ) ´109

Table S4: Proteins differentially expressed (2-fold threshold, P<0.05) in the fatty acid overproducing strain grown in EZ rich defined medium supplemented with 0.2% glucose

Protein name and BTE/BTE-H204A

gene locus Gene product/function mid-log ratio early stat. ratio mid-stat. ratio

Increased expression

FadE b0221 acyl coenzyme A dehydrogenase - - ¥

GltA b0720 citrate synthase - - 2.05

SucA b0726 2-oxoglutarate decarboxylase, thiamin-requiring - - 2.43

MoaB b0782 molybdopterin biosynthesis protein B - - 2.03

OmpX b0814 outer membrane protein X - - 3.10

ClpA b0882 ATPase and specificity subunit of ClpA-ClpP ATP-dependent serine 2.23 - 3.33

protease, chaperone activity

Agp b1002 glucose-1-phosphatase / inositol phosphatase - 2.71 2.62

PutA b1014 fused DNA-binding transcriptional regulator / proline dehydrogenase / - - 2.10

pyrroline-5-carboxylate dehydrogenase

AdhE b1241 fused acetaldehyde-CoA dehydrogenase / iron-dependent alcohol 2.04 - 2.14

dehydrogenase / pyruvate-formate lyase deactivase

PspA b1304 regulatory protein for the phage-shock-protein operon - - 5.52

DbpA b1343 ATP-dependent RNA helicase, specific for 23S rRNA - 2.66 -

YncB b1449 predicted NADP-dependent, Zn-dependent oxidoreductase - - 2.38

Sra b1480 stationary-phase-induced ribosome-associated protein - 2.29a -

GadB b1493 glutamate decarboxylase B, PLP-dependent - - 4.63

LsrF b1517 putative autoinducer-2 (AI-2) aldolase - ¥ -

FumC b1611 fumarate hydratase (fumarase C), aerobic Class II - - 3.53

Spy b1743 envelope stress induced periplasmic protein - - 5.24

YeaG b1783 protein kinase, function unknown; autokinase - - 2.12

FliC b1923 flagellar filament structural protein (flagellin) - - 2.48

FliD b1924 flagellar filament capping protein - - ¥

HchA b1967 Hsp31 molecular chaperone 2.28 - 4.15

GatA b2094 galactitol-specific enzyme IIA component of PTS - - 5.57

GatZ b2095 subunit of tagatose-1,6-bisphosphate aldolase 2 2.23 - -

FadL b2344 long-chain fatty acid outer membrane transporter - - 2.02

TalA b2464 transaldolase A - - 3.45

YfiD b2579 autonomous glycyl radical cofactor 2.73 - -

RaiA b2597 cold shock protein associated with 30S ribosomal subunit - 2.32 -

GabD b2661 succinate-semialdehyde dehydrogenase I, NADP-dependent - 2.82 3.63

GlcB b2976 malate synthase G - 2.62 -

GlcG b2977 conserved protein - - 2.22

ExbB b3006 membrane spanning protein in TonB-ExbB-ExbD complex - - 3.54

DkgA b3012 2,5-diketo-D-gluconate reductase A - - 3.84

YhcB b3233 conserved protein - - 2.02

AaeA b3241 p-hydroxybenzoic acid efflux system component - - 2.61

OmpR b3405 DNA-binding response regulator in two-component regulatory system - - 2.56

with EnvZ

Slp b3506 outer membrane lipoprotein - - 2.10

YhhA b3448 conserved protein, DUF2756 family - - 4.02

LivJ b3460 leucine/isoleucine/valine transporter subunit - - 3.15

XylF b3566 D-xylose transporter subunit - - 2.16

AldB b3588 aldehyde dehydrogenase B - - 4.61

MtlA b3599 subunit of mannitol PTS permease - 2.45 2.96

MtlD b3600 mannitol-1-phosphate dehydrogenase, NAD(P)-binding - - 2.14

LldD b3605 L-lactate dehydrogenase, FMN-linked - - 4.42

EnvC b3613 activator of AmiB,C murein hydrolases, septal ring factor - - 2.26

TnaA b3708 tryptophanase / L-cysteine desulfhydrase, PLP-dependent - - 4.42

CorA b3816 magnesium/nickel/copper transporter - - 2.19

Fre b3844 NAD(P)H-flavin reductase - 2.33 -

FadA b3845 3-ketoacyl-CoA thiolase (thiolase I) - - 4.18

GlpK b3926 glycerol kinase - - 2.39

Acs b4069 acetyl-CoA synthetase - 3.01 2.60

DcuB b4123 C4-dicarboxylate antiporter - - 2.04

AspA b4139 aspartate ammonia-lyase - - 2.29

FrdB b4153 fumarate reductase iron-sulfur protein 2.05 - -

YtfQ b4227 galactofuranose binding protein: periplasmic-binding component of - - 4.18

ABC superfamily

YjiY b4354 predicted inner membrane protein 2.73 - -

Decreased expression

CarA b0032 carbamoyl phosphate synthetase small subunit, glutamine amidotransferase - -2.04 -

PsiF b0384 conserved protein, PsiF family, pho regulon - -5.20 -5.14

YaiE b0391 conserved protein, UPF0345 family - -2.08 -

IspE b1208 4-diphosphocytidyl-2-C-methylerythritol kinase - -¥ -

LsrB b1516 autoinducer-2 binding protein - -2.32 -

Table S4 (cont.): Proteins differentially expressed (2-fold threshold, P<0.05) in the fatty acid overproducing strain grown in EZ rich defined medium supplemented with 0.2% glucose

Protein name and BTE/BTE-H204A

gene locus Gene product/function mid-log ratio early stat. ratio mid-stat. ratio

Decreased expression (cont.)

HdhA b1619 7-α-hydroxysteroid dehydrogenase, NAD dependent - -2.02 -

YebV b1836 predicted protein - - -2.76

Amn b1982 AMP nucleosidase - -3.06 -

BglX b2132 β-D-glucoside glucohydrolase, periplasmic - -2.06 -

PurF b2312 amidophosphoribosyltransferase - -2.03 -

FabB b2323 3-oxoacyl-[acyl carrier protein] synthase I - -4.20 -3.46

YfeR b2409 predicted DNA-binding transcriptional regulator -¥ - -

PurM b2499 phosphoribosylaminoimidazole synthetase - - -2.49

StpA b2669 DNA binding protein, nucleoid-associated - - -2.43

MltA b2813 membrane-bound lytic murein transglycosylase A - -2.54 -

SspA b3229 stringent starvation protein A - -2.26 -

UgpB b3453 glycerol-3-phosphate transporter subunit - -8.18 -2.52

BcsA b3533 cellulose synthase, catalytic subunit - -¥ -¥

PstB b3725 phosphate transporter subunit - -3.78 -3.15

IlvD b3771 dihydroxyacid dehydratase - - -2.49

GlnA b3870 glutamine synthetase - - -2.19

MetB b3939 cystathionine γ-synthase, PLP-dependent - -3.97 -3.16

MetL b3940 fused aspartokinase II / homoserine dehydrogenase II - - -2.39

MetF b3941 5,10-methylenetetrahydrofolate reductase - -2.98 -

PyrI b4244 aspartate carbamoyltransferase, regulatory subunit - -2.35 -2.39

YjiH b4330 predicted inner membrane protein -¥ - -

Bolded protein names also were differentially expressed greater than 2.0-fold (P<0.05) as transcripts at any of the three sampling points.

a No transcript data has been obtained for this gene.

Table S5: Proteins differentially expressed (2-fold threshold, P<0.05) in the fatty acid overproducing strains (BTE+ ACC+, BTE+ ACC-) grown in EZ rich defined medium supplemented with 0.4% glycerol

Protein name and (BTE+)/(BTE- ACC-)

gene locus Gene product/function late log ratio mid-stat. ratio

Increased expression (BTE+ ACC-)

PutA b1014 fused DNA-binding transcriptional regulator / proline dehydrogenase / 2.20 -

pyrroline-5-carboxylate dehydrogenase

YddK b1471 predicted protein 2.53 -

YdhC b1660 predicted transporter - 2.43

Decreased expression (BTE+ ACC-)

OppD b1246 oligopeptide tranporter subunit - -2.05

GatZ b2095 D-tagatose 1,6-bisphosphate aldolase 2, subunit - -2.56

ArnC b2254 undecaprenyl phosphate-L-Ara4FN transferase - -¥

FabB b2323 3-oxoacyl-[acyl-carrier-protein] synthase I -2.36 -5.85

Slp b3506 outer membrane lipoprotein - -2.11

Increased expression (BTE+ ACC+)

AccA b0185 acetyl-CoA carboxylase, carboxytransferase, α subunit 4.18 7.39

MiaB b0661 tRNA-i(6)A37 methylthiotransferase - 2.17

PutA b1014 fused DNA-binding transcriptional regulator / proline dehydrogenase / - 4.32

pyrroline-5-carboxylate dehydrogenase

PspA b1304 regulatory protein for phage-shock-protein system - 2.28

YmgA b1165 connector protein for RcsB regulation of biofilm - ¥

TrpD b1263 fused glutamine amidotransferase (component II) of anthranilate synthase / - 2.04

anthranilate phosphoribosyl transferase

Trg b1421 methyl-accepting chemotaxis protein III, ribose and galactose sensor receptor - 2.13

YddK b1471 predicted protein - 3.90

CheB b1883 fused chemotaxis regulator: protein-glutamate methylesterase in two-component - 2.05

regulatory system with CheA

AccB b3255 acetyl-CoA carboxylase, BCCP subunit - 30.6

AccC b3256 acetyl-CoA carboxylase, biotin carboxylase subunit 3.76 38.8

FrwD b3953 predicted enzyme IIB component of PTS - ¥

Decreased expression (BTE+ ACC+)

LeuD b0071 3-isopropylmalate dehydratase small subunit - -2.27

LeuC b0072 3-isopropylmalate dehydratase large subunit - -2.65

PhoA b0383 bacterial alkaline phosphatase - -28.3

Rnk b0610 regulator of nucleoside diphosphate kinase - -2.15

LipA b0628 lipoate synthase - -2.25

OppB b1244 oligopeptide transporter subunit - -2.91

OppD b1246 oligopeptide transporter subunit - -2.56

OppF b1247 oligopeptide transporter subunit - -3.23

YciF b1258 predicted ruberythrin/ferritin-like metal-binding protein - -2.25

PptA b1461 4-oxalocrotonate tautomerase - -¥

GatZ b2095 D-tagatose 1,6-bisphosphate aldolase 2, subunit - -3.91

FbaB b2097 fructose-bisphosphate aldolase class I - -2.58

ElaB b2266 conserved protein - -2.44

FabB b2323 3-oxoacyl-[acyl-carrier-protein] synthase I -2.46 -7.00

TalA b2464 transaldolase A - -2.48

CysH b2762 3'-phosphoadenosine 5'-phosphosulfate reductase - -3.32

YgiM b3055 SH3 domain protein - -2.32

DeaD b3162 ATP-dependent RNA helicase - -4.22

PstB b3725 phosphate transporter subunit - -3.25

IlvC b3774 ketol-acid reductoisomerase, NAD(P)-binding - -6.03

GlnA b3870 glutamine synthetase -2.90 -

Ppc b3956 phosphoenolpyruvate carboxylase - -2.65

Bolded protein names also were differentially expressed greater than 2.0-fold (P<0.05) as transcripts at any of the three sampling points.

Table S6: Viable cell counts (CFU mL-1) 8 h post-inoculation from induced cultures of RL08 harboring plasmids pBAD33-BTE-H204A or pBAD33-BTE with additional specified plasmids grown in LB medium supplemented with 0.4% glycerol.

Viable cell counts (CFU mL-1)

Strain BTE-H204A BTE

RL08/pBAD18 (3.24 ± 0.11) ´109 (5.3 ± 1.6) ´108

RL08/pBAD18-Psp (1.59 ± 0.23) ´109 (6.8 ± 3.5) ´107

RL08/pBAD18 (2.34 ± 0.23) ´109 (2.94 ± 0.78) ´108

RL08/pBAD18-MarA (2.74 ± 0.55) ´109 (4.5 ± 2.6) ´108

RL08/pBAD18-Rob (2.31 ± 0.18) ´109 (2.0 ± 1.0) ´108

RL08/pBAD18-SoxS (2.97 ± 0.69) ´109 (4.9 ± 2.3) ´108

Figure S1: Expression levels of BTE and BTE-H204A at all protein sampling times in strain RL08/pTrc99A-BTE (BTE) and pTrc99A-BTE-H204A (H204A) grown in EZ rich defined medium supplemented with 0.2% glucose. Error bars represent the propagated standard deviations for the rolled-up protein abundances normalized to the OD600 at that sampling point.

Figure S2: Flow cytometry analysis of SYTOX Green stained RL08 and RL08/pTrc99A exposed to either 0.5 g L-1 lauric acid (from a stock solution in ethanol), or an equivalent volume of ethanol (corresponding to 1%) at an OD600 of approximately 0.2. (a) averaged forward scatter histograms at 4.5 h (transition between log and stationary phase). (b) averaged forward scatter histograms at 10 h (mid-stationary phase). (c) averaged green fluorescence histograms at 4.5 h. (d) averaged green fluorescence histograms at 10 h. RL08 and RL08/pTrc99A exhibited similar forward scatter distributions indicative of similar cell size distributions with and without exogenous addition of lauric acid. Only a small percentage of RL08 and RL08/pTrc99A exposed to lauric acid at both sampling times exhibited bright green fluorescence indicative of compromised inner membrane integrity by SYTOX Green staining.

Figure S3: Individual growth curves of strain RL08 harboring pBAD33-ACC and pBAD35-BTE (ACC+ BTE+), pBAD33 and pBAD33-BTE-H204A (ACC- BTE-), and pBAD33 and pBAD35-BTE (ACC- BTE+) grown in fermentors as described in Materials and Methods. Each strain was grown in biological duplicate and is indicated above by a separate curve. The sampling times for RNA and protein are indicated by the enlarged and circled points (late log phase, early stationary phase, and mid-stationary phase). Proteins were only measured at OD600 2.0 and at mid-stationary phase. The increase in OD600 observed between 10 and 15 hours for one replicate of the ACC- BTE- strain (black circles) corresponded to a pressure increase due to a clogged outlet filter.

Figure S4: Fatty acid production from fermentor runs described in Figure S2. Top: Combined titer of medium chain fatty acids (C8:0, C9:0, C10:0, C10:1, C11:0, C12:0, C12:1, C14:0, C14:1) over the course of the bioreactor runs. Note that fatty acid titer increases around the time of transition to stationary phase. The drop in fatty acid titer observed after 15 hrs is due to culture foaming (which was limited by addition of antifoam 204) which deposits fatty acids above the liquid height (sampling point) of the vessel. Bottom: Percentage of unsaturated fatty acids (C16:1 and C18:1) relative to the total C16 and C18 fatty acid pool. These fatty acids are the common constituents of lipids found in the inner membrane. Note the difference in stationary phase (after 10 hours) between the BTE+ (white and grey symbols) and BTE- (black symbols) cultures.