Supplementary Materials

Mechanism of mRNA Destabilization by the glmS ribozyme

Jennifer A. Collins, Irnov Irnov, Stephanie Baker, and Wade C. Winkler

The following table includes a brief description of DNA oligonucleotides used in this study.

OLIGO / SEQUENCE (5`-> 3`) / DESCRIPTION
IRV5 / AAAGAATTCTAAAAAACAATTGACCGTTTATGCCACATGTTGTAAAATCAAGCTTGCGCCCGAACTAAGCG / Forward primer for moving the transcription start site of glmS to the site of ribozyme self-cleavage. Through use of this oligo, the endogenous glmS promoter region was grafted to the G+1 at the site of self-cleavage.
IRV13 / GTTCGGTATGGGAACGGG / Reverse primer for B. subtilis 5S RNA.
IRV18 / CCCTACTCTCGCATGGGGAG / Reverse primer for E. coli 5S rRNA (rrfB); about 100 nt from the 5' end; to be used for Northern blot
IRV27 / GATCGCACCATGGCAAAATTTGTAAAAAATGATCAG / Forward primer for amplification of RNase J1 (ykqC); put into pBADMycHis-A with irv28
IRV28 / TGCGATCAAGCTTTTAAACCTCCATAATGATCGG / Reverse primer amplification of RNase J1; put into pBADMycHis-A with irv27
IRV43 / TAATACGACTCACTATAGGGTCCCCTCCTACATG / Forward primer with T7 promoter to make anti-sense probe to glmS UTR. Corresponds to nucleotides +70 to +81 relative to self-cleavage site. Used in combination with irv44.
IRV44 / CTTGTTCTTATTTTCTCAATAGG / Reverse primer to make anti-sense probe to glmS UTR. Corresponds to nucleotides -60 to -38 relative to self-cleavage site. Use with irv43.
IRV104 / TTTGGTGGCGATAGCGAAGAG / Reverse primer to synthesize anti-sense probe to B. subtilis 5S RNA. Corresponds to nucleotides +1 to +21 of rrnB. Used in combination with irv105
IRV105 / TAATACGACTCACTATAGGGCTTGGCGGCGTCCTACTCTC / Forward primer with T7 promoter to make anti-sense probe to B. subtilis 5S RNA. Corresponds to nucleotides +96 to +116 of rrnB. Used in combination with irv104.
IRV120 / CGACTACCATCGGCGCTGAA / Primer used for synthesis of anti-sense probe to B. subtilis 5S RNA. Corresponds to nucleotides +61 to +80 relative to rrnB translation start site.
IRV134 / AAGATCGGGGTGGGGGTCTAAGATCGGGGTGGGGGTCTCAGCAAATTGGCGATTAAGCCAGTTTGTTGATC / Reverse primer for E. coli hammerhead-rpsT experiment, to be used with irv133; goes down to 14 nts after rpsT stop codon, add rpstT "tag" (18 nts, to separate this from endogenous copy of rpsT)
IRV135 / GATCTCTAGAATAAAAAAACCCGCTTGCGCGGGCTTTTTCACAAAGCTAAGAATCGGGGTGGGGGTCT / Reverse primer for E. coli hammerhead-rpsT, to be used with irv132, will add terminator; overlap with rpsT tag (18 nts), basically ends at the natural terminator of rpsT
IRV136 / AAGATCGGGGTGGGGGTCT / Reverse primer for rpsT "tag", to be used for Northern blot of rpsT so it can be differentiated from the chromosomal copy of rpsT
IRV144 / GTAAAATCAAGCTTGATTATAATAAGATCCCGCTCGAGCGGGATCAGTGATCTGAAGAGCCGAAAG / Forward primer for E. coli hammerhead-rpsT experiment, includes 10 last nt from glmS promoter, 50 nts into the hammerhead construct (see Celesnik et al 2007); 25 nts overlap with irv146
IRV145 / AAAAGCATGCACAATTGACCGTTTATGCCACATGTTGTAAAATCAAGCTTGATTATAATAAGATCCC / Forward primer for E. coli hammerhead-rpsT experiment, include glmS promoter + 15 nts overlap with hammerhead; use after irv144. This primer comes from dividing irv132 into two parts to avoid primer dimer
IRV146 / GATCAGTGATCTGAAGAGCCGAAAGGCGAAACACGCGTAAGCGTGTCATCACTACGTAACGAGTGCC / Forward primer for E. coli hammerhead-rpsT experiment, start at nt 30 of hammerhead construct (see Celesnik et al 2007); 30 nts overlap with irv145; 20 nts overlap to rpsT transcript
JC10 / GGTTTGAATTCGATAATTGTGAGACATACGG / Forward primer for amplification of B. subtilis glmS intergenic region. Adds EcoR1 site upstream of promoter.
JC11 / TAAAATTGGATCCGCATCAAGCTGACCG / Reverse primer for amplification of glmS UTR. Corresponds to nucleotides +24 to +39 relative to glmS translation start site. Adds BamHI site.
JC29 / GACTTTCTTCGTCGACTTTTACAATCTTAGGAGG / Forward primer for amplification of B. subtilis glmS coding region. Adds restriction site for cloning into plasmid pDG148 (BGSC, Ohio)
JC30 / CACCCCTTTAGATAAGCATGCCCAAAGGGGTTAAAC / Reverse primer for amplification of B. subtilis glmS coding region. Adds restriction site for cloning into plasmid pDG148 (BGSC, Ohio)
JC43 / TTACGGCTGTGATCTGCACACT / Reverse primer for glmS UTR, used for primer extension analyses. Corresponds to nucleotides +82 to +103 relative to ribozyme self-cleavage site.
WCW257 / AGCGGTTGGATCCTTCGGTCCTCCGATC / Forward primer for amplification of erm from plasmid pMUTIN4 (BGSC, Ohio).
WCW258 / AGTCATTTCTAGATCTCACTGCAGAGATCCC / Reverse primer for amplification of erm from plasmid pMUTIN4 (BGSC, Ohio).
WCW259 / CACCAGTCTAGACACTGGCAACTCAAGAGC / Forward primer for amplification of the dowstream portion of B. subtilis glmS gene.
WCW260 / TATTACTCTGCAGTAACACTCTTCGCAAGG / Reverse primer for amplification of the dowstream portion of B. subtilis glmS gene.
WCW261 / AACTGAAGAATTCGTCCGTGTCATGG / Forward primer for amplification of the upstream portion of B. subtilis glmS UTR.
WCW407 / TAATACGACTCACTATAGGGCGGCGTCCTACTCTCAC / Reverse oligo for amplification of B. subtilis 5S RNA. Used for synthesis of an antisense RNA probe Adds a T7 RNA polymerase promoter.
WCW408 / GCGGAATTCAAGCTTTTTGGTGGCGATAGCGAAG / Forward oligo for amplification of B. subtilis 5S RNA.
WCW409 / GCGGAATTCAAGCTTGCGGAATTCAAGCTTGTTCTTATTTTCTC / Forward oligo for amplification of glmS ribozyme. Used for synthesis of an antisense RNA probe.
WCW410 / TAATACGACTCACTATAGGGCTTCGCATCAAGCTGACCG / Reverse oligo for amplification of glmS ribozyme. Used for synthesis of an antisense RNA probe. Adds a T7 RNA polymerase promoter.
WCW417 / CATAAGAGAATTCTGAGACATACGGCAAAG / Forward primer for amplification of glmS promoter region.
WCW418 / ATTGAGAGGATCCGAACAAGACAAGCTTG / Reverse primer for amplification of glmS promoter region.

Figure S1. Northern blot analyses of different wild-type glmS and M9 containing transcripts. RNA was extracted from B. subtilis strain BR151 containing M9-lacZ fusion (left lane) and GP41 containing glmS ribozyme-lacZ fusion grown in the absence of 1 % xylose (right lane). Total RNA samples were resolved by 1.5% formaldehyde denaturing agarose gel and probed with glmS antisense RNA probes to the glmS UTR (see Methods for further details). M9-containing transcripts are indicated with square boxes, while transcripts containing the wild-type ribozyme are indicated with circles. Red denotes transcripts containing lacZ , blue denotes small RNA species which corresponds to the glmS 5`-UTR, and green denotes the endogenous glmS transcripts. The migration of RNA size standards are shown on the far left (indicated with grey circles).

Figure S2.

The 3`-cleaved product of the glmS ribozyme self-cleavage contains a 5`-hydroxylOH in vivo. The 5`-phosphorylation state of the transcripts was analyzed using PABLO (Phosphorylation Assay By Ligation of Oligonucleotides) as described in Celesnik et al. 2007 with some minor modifications. RNA was mixed with 2 µM of the DNA oligonucleotide IRV130 (5`- AAAAAAAAAAAAAAAAAAAACAAGTTATCATTCATATTGTTC-3`; denoted as C in the schematic above) and a “splint” DNA oligonucleotide IRV131 (5`-CGGGCGCTTAGTTCGGGCGCGAACAATATGAATGATAACTTG-3’; denoted as B above) in a final volume of 25 µl, heated to 75 oC for 5 minutes and slowly cooled to 30 oC. Reaction mixtures containing 2x T4 DNA ligase buffer (Roche), 2 mM ATP, and 10 units of T4 DNA ligase (Roche) was added and incubated at 37 oC for 4 hours. The reactions were then phenol extracted, ethanol precipitated, resolved by 6 % denaturing PAGE and analyzed by Northern blotting using an antisense RNA probe (see Methods). These assays waswere doneperformed using either synthetic RNA (0.02 pmol) transcribed in vitro with GlcN6P (generating transcript with 5`OH) from PCR templates generated from WCW426 (5`-TAATACGACTCACTATAGGGTCTTGTTCTTATTTTCTCAATAGG-3`) - JC11 oligonucleotide primer pairs (in vitro transcription protocol was described in Dann et al. 2007) or total RNA (10 µg). The latter RNA was harvested from GP41 a strains (GP41) containing a wild-type glmS ribozyme-lacZ fusion and that was depleted for RNase J1 (i.e., grown cultured in the absence of xylose; see Methods for further detail). The synthetic RNA was transcribed in vitro in the presence of 2.5 mM GlcN6P (thereby generating the 3`-cleaved product with a 5`hydroxyl group) from PCR templates generated using WCW426 (5`-TAATACGACTCACTATAGGGTCTTGTTCTTATTTTCTCAATAGG-3`) and JC11 oligonucleotides. Details for in vitro transcription are described elsewhere (Dann et al. 2007). The RNA samples were either treated with T4 polynucleotide kinase (New England Biolabs) under standard conditions or left untreated. Briefly, RNA was mixed with 2 µM of oligo IRV130 (5`- AAAAAAAAAAAAAAAAAAAACAAGTTATCATTCATATTGTTC-3`; denoted as C in the schematic above) and the “splint” oligo IRV131 (5`-CGGGCGCTTAGTTCGGGCGCGAACAATATGAATGATAACTTG-3’; denoted as B) in the final volume of 25 µl, heated to 75 oC for 5 minutes, and slowly cooled to 30 oC.