Material and Methods
Listeria monocytogenes EGD and EGD-e sequencing and annotation.
Whole-genome sequencing of EGD strain was performed with an Illumina single-reads sequencing technology with an insert length of 400 bp. Genomic DNA was prepared using cetyl-trimethyl-ammonium bromide (CTAB) and alkaline lysis as described (1). Bacteria were previously treated with 20 mg/mL lysozyme for 20 min at 37ºC in Tris-EDTA-sucrose buffer. Samples were further treated with 0.5 mg/mL RNase A (bovine pancreas, Roche) for 30 min at 37ºC and a same volume of phenol was added. Chromosomal DNA was then precipitated with isopropanol, washed in 70% (v/v) ethanol and air-dried before suspending in MiliQ-filtered water. Absence of contaminating RNA was tested by measuring the A260/A280 absorbance ratio, which was in all samples of ~2.0. Fragment library preparation was constructed using NEBNext DNA Sample Prep Master Mix Set1 (Illumina Compatible) (New England BioLabs) with Multiplexing Sample preparation oligonucleotide (Illumina, San Diego, CA). Briefly, genomic DNA was sheared using NEBNext DNA Fragmentase kit (New England BioLabs), and sheared fragments were end-repaired and phosphorylated. Blunt-end fragments were A-tailed, and sequencing adapters were ligated to the fragments. Fragments with an insert size of around 400 bp were gel-extracted and enriched with 18 cycles of PCR before library quantification and validation. Hybridization of the library to the flow cell and bridge amplification was performed to generate clusters (HiSeq cluster generation v2. SR), and single reads of 100 cycles (HiSeq Sequencing kit) were collected on a HiSeq 2000 (Illumina Genome Analyzer HiSeq 2000). After sequencing was complete, image analysis, base calling, and error estimation were performed using Illumina Analysis Pipeline version 1.7.).After quality-filtering 25 827 948 reads were aligned to Listeria monocytogenes 10403S genome sequence (Accession number: CP002002) using CLC Genomics WorkBench (version 3.20), more than 98.4 % of reads mapped successfully. Remaining 407195 reads were then used to sequentially fill gaps in the final sequence. The overall final coverage is 875X with only 47125 unmapped reads. EGD-e was sequenced using same protocole with a total of 13 414 584 reads.
The consensus sequence of EGD has been exported and annotated using RAST annotation software (2). Automatic annotation provided by RAST was curated using homology to protein in Listeria monocytogenes EGD-e (3) and Listeria monocytogenes 10403S. A total of 105 predicted ORFs start site in EGD were modified using the size of the homolog in 10403S, 27 RAST predicted EGD ORFs were removed.Interactive visualization of the syntenic organization of Listeria genomesis available in the Flash-based SynTView software:
Construction of the PrfA* strain
We constructed a L. monocytogenes EGD-e PrfA* strain (BUG 3057) expressing a constitutively active form of PrfA carrying a point mutation (G145S). The prfA gene and its flanking regions were amplified by PCR using genomic DNA from EGD-e wild-type (BUG 1600) and the oligonucleotides PrfA*-A/PrfA*-B and PrfA*-C/PrfA*-D (see below), designed to introduce a silent point mutation in Cys144 (codon TGC to TGT) and a missense point mutation in Gly145 rendering it to Ser145 (codon GGT to TCT). This fragment was then cloned into the thermosensitive vector pMAD and the PrfA* strain has been generated by allelic exchange as previously described (4). The resulting sequence (TGT TCT) carries a restriction site for MwoI restriction enzyme that allowed us to screen the PrfA* mutants. The PrfA activity of the PrfA* strain has been tested for hemolytic activity by spotting 10 µl of the mutant and wild type bacteria overnight cultures onto Columbia blood agar plates and by immunofluorescence for expression of inlA.
PrfA*-A / GCTAACAATTGTTGTTACTGCCPrfA*-B / GATTAAAAGTTGAGAACAAATAGAGCC
PrfA*-C / CTATTTGTTCTCAACTTTTAATCCTGAC
PrfA*-D / CAATCACACTTGCTGCTAAAG
RNA isolation
Bacterial overnight cultures were diluted in BHI and bacteria were grown until OD = 1. After washing in PBS, the bacterial pellets were resuspended in 400 ml solution A (1/2 Glucose 20% + 1/2 vol Tris 25mM pH 7.6 + EDTA 10mM) to which an additional 60 ml of 0.5M EDTA was added. RNAs were subsequently extracted using classical TRIzol/chloroform protocol as described previously (5). RNA quality was determined using the Experion Automated Electrophoresis Station (Bio-Rad).
Transcriptomic analysis
A total of 10 μg of total RNA was used per chip. Sample preparation for each chip was then processed following the Affymetrix GeneChip Expression Analysis Technical Manual (P/N 702232 Rev. 2) as previously described (5).
Tiling chip contains two types of array: GeneExpression array (E-MTAB-1676) and Tiling array (E-MTAB-1677). GeneExpression arrays were normalized using RMA technique (6). Tiling arrays were normalized using DNA reference normalization (7) against a wild-type strain grown in BHI at 37 degrees. Both normalizations were followed by a median normalization. As expression values are already log transformed relative expression is equivalent to the log2 (fold change). The fold-change was retrieved by the operation, if , and , if .
We calculated using the FDRBY (8) technique, the mean of corrected GeneExpression LPE test (9)p-value and corrected Tiling array t-test p-value, the result was simply called FDRBY p-value. Genes having a FDRBY value under 0.05 and absolute value >1.5 were selected as potential differentially expressed gene. For small RNAs we apply the cut-off: t-test p-value 0.05 and >1.5, after manual curation we obtained a potential list of differentially expressed sRNAs.
Quantitative RT-PCR (qRT-PCR)
Total L. monocytogenes RNAs (1 mg) were reverse transcribed using iScript cDNA synthesis (Biorad). Diluted cDNAs (1/10) were used as templates for PCR using SYBR Green PCR Master mix (Applied Biosystems) and detected using Real-Time PCR system ABI PRISM 7900HT (Applied Biosystems). Expression has been normalized to expression of the gyrase (lmo0007)gene. A two-tailed unpaired t test was used on three independent experiments.
Bacterial lysis and cell wall extraction and protein detection
For preparation of whole bacteria lysates, bacteria of over-night cultures were washed3 times in PBS and lysed in 200μl Laemmli buffer, containing 10% DTT, boiled for 10min and sonicated. For cell wall extraction, bacteria of an over-night culture were washed once with PBS and once with TS buffer (10mM Tris-HCL pH 6.9, 10mM MgCl2, 0.5M sucrose). Cell walls were separated from protoblasts by incubation in 500ul TS buffer containing 60ug/ml Mutanolysin, 250ug/ml RNase A and 1:25 protease inhibitor mix 25x (Roche) for 1h at 37°C followed by centrifugation at 15000g. 5x Laemmli buffer, containing 10% DTT was added to the supernatant corresponding to the cell wall fraction. Samples were boiled for 10min before electrophoresis.
Expression levels of InlA, InlB, LLO and EF-Tu were assayed by Western blot on PVDF membranes and immunodetection using monoclonal mouse antibodies for InlA (L7.7), InlB (mix of clones B4.6, 9.1, A13.1, D23.1, 3.3), or polyclonal rabbit derived antibodies for LLO (R176) and EF-Tu (R114, (10)).
In vivo studies
All experiments involving mice were handled in accordance with the Pasteur Institute
guidelines for animal welfare.Listeria monocytogenes cultures were grown in broth BHI medium (Difco) at 37°C to an OD600 = 1. After washing, the pellets were re-suspended in sterile PBS. 8-week-old BALB/c mice (Charles River) were injected intravenously in the tail with 104 CFU (colony forming unit) per mouse. Liver, spleen and blood samples were recovered 72 h after infection. The organs were disrupted in 2 ml of PBS. Serial dilutions of organ homogenates and of the mouse blood were plated on BHI agar plates and CFU determined.
Plaque assay
The procedure was adapted from Kuhn et al. (11). L2 epithelial cells (ATCC-CCL-149) from Rattus norvegicuswere grown in Ham’s F12K medium (GIBCO, Life Technologies) containing 10% fetal calf serum (FCS), 2 mM L-glutamine. At 24 h prior to use, 1.35x106 L2 cells were seeded in each well of 6-well tissue culture dishes and incubated in medium. Before the infection, monolayers were washed three times with medium without FCS, and infected at different multiplicity of infection (MOI). Infected cells were subsequently incubated at 37°C for 1 h and then washed several times with medium. An agarose overlay (2 mL of 2% agarose in MEM medium without phenol red supplemented with 10% FCS, 2 mM L-glutamine, 1mM of Na-pyruvate and 20 mg of gentamicin per mL) was then added to each well. Following a 48 h incubation at 37°C, cells were fixed with paraformaldehyde (4% in PBS for 20 min), agarose was removed, cells were stained with 1% crystal violet for 5 min and washed extensively with water until plaques appeared.
In order to measure the plaque size we needed to have the same number of plaques on each well for each bacterium. We thus selected EGD-e MOI 0.1, EGD-e PrfA* MOI 0.001, 10403S MOI 0.5, and EGD MOI 0.001. Directly on a photo of the plaques we measured plaque size (in pixel2) using the interior value of Region of Interests (ROI) manually defined in Icy software (12). Almost 30 plaque sizes were measured for each bacterium. Unpaired t-test was used to assess plaque size differences between strains.
1. Wilson K. 2001. Preparation of genomic DNA from bacteria. Curr. Protoc. Mol. Biol. Chapter 2:Unit 2.4.
2. Aziz RK, Bartels D, Best A a, DeJongh M, Disz T, Edwards R a, Formsma K, Gerdes S, Glass EM, Kubal M, Meyer F, Olsen GJ, Olson R, Osterman AL, Overbeek R a, McNeil LK, Paarmann D, Paczian T, Parrello B, Pusch GD, Reich C, Stevens R, Vassieva O, Vonstein V, Wilke A, Zagnitko O. 2008. The RAST Server: rapid annotations using subsystems technology. BMC Genomics 9:75.
3. Glaser P, Frangeul L, Buchrieser C, Rusniok C, Amend A, Baquero F, Berche P, Bloecker H, Brandt P, Chakraborty T, Charbit A, Chetouani F, Couvé E, de Daruvar A, Dehoux P, Domann E, Domínguez-Bernal G, Duchaud E, Durant L, Dussurget O, Entian KD, Fsihi H, García-del Portillo F, Garrido P, Gautier L, Goebel W, Gómez-López N, Hain T, Hauf J, Jackson D, Jones LM, Kaerst U, Kreft J, Kuhn M, Kunst F, Kurapkat G, Madueno E, Maitournam A, Vicente JM, Ng E, Nedjari H, Nordsiek G, Novella S, de Pablos B, Pérez-Diaz JC, Purcell R, Remmel B, Rose M, Schlueter T, Simoes N, Tierrez A, Vázquez-Boland J a, Voss H, Wehland J, Cossart P. 2001. Comparative genomics of Listeria species. Science (80-. ). 294:849–52.
4. Arnaud M, Chastanet A, Débarbouillé M. 2004. New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl. Environ. Microbiol. 70:6887–91.
5. Toledo-Arana A, Dussurget O, Nikitas G, Sesto N, Guet-Revillet H, Balestrino D, Loh E, Gripenland J, Tiensuu T, Vaitkevicius K, Barthelemy M, Vergassola M, Nahori M-A, Soubigou G, Régnault B, Coppée J-Y, Lecuit M, Johansson J, Cossart P. 2009. The Listeria transcriptional landscape from saprophytism to virulence. Nature 459:950–6.
6. Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U, Speed TP. 2003. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 4:249–64.
7. Huber W, Toedling J, Steinmetz LM. 2006. Transcript mapping with high-density oligonucleotide tiling arrays. Bioinformatics 22:1963–70.
8. Jain N, Cho H, O’Connell M, Lee JK. 2005. Rank-invariant resampling based estimation of false discovery rate for analysis of small sample microarray data. BMC Bioinformatics 6:187.
9. Jain N, Thatte J, Braciale T, Ley K, O’Connell M, Lee JK. 2003. Local-pooled-error test for identifying differentially expressed genes with a small number of replicated microarrays. Bioinformatics 19:1945–1951.
10. Archambaud C, Gouin E, Pizarro-Cerda J, Cossart P, Dussurget O. 2005. Translation elongation factor EF-Tu is a target for Stp, a serine-threonine phosphatase involved in virulence of Listeria monocytogenes. Mol. Microbiol. 56:383–96.
11. Kuhn M, Prevost M, Mounier J, Sansonetti PJ. 1990. A nonvirulent mutant of Listeria monocytogenes does not move intracellularly but still induces polymerization of actin . A Nonvirulent Mutant of Listeria monocytogenes Does Not Move Intracellularly but Still Induces Polymerization of Actin 58.
12. De Chaumont F, Dallongeville S, Chenouard N, Hervé N, Pop S, Provoost T, Meas-Yedid V, Pankajakshan P, Lecomte T, Le Montagner Y, Lagache T, Dufour A, Olivo-Marin J-C. 2012. Icy: an open bioimage informatics platform for extended reproducible research. Nat. Methods 9:690–6.