Lesson 8 DNA Fingerprinting s1

Lesson 8 DNA Fingerprinting

Pre-Lesson Reading:

1. What is cell?

a. Cells are the basic building blocks of all living things.

b. Human body is composed of trillions of cells.

c. Cells provide structure for a body, take in nutrients from food, convert nutrients into energy, and carry out specialised functions.

2. What is DNA?

a. In a cell, DNA (deoxyribonucleic acid) molecules are packaged in chromosomes within the nucleus.

b. In a human body cell, there are 23 pairs of chromosomes.

c. DNA (deoxyribonucleic acid) is a large, polymeric molecule. A gene is a segment of DNA molecule of a chromosome. It is the basic unit of heredity. Genes determine the body characteristics of an organism. Each inherited characteristic is controlled by one or several genes.

d. DNA (deoxyribonucleic acid) is found in nearly every cell in the body. One significant exception is red blood cells (lack nuclei).

e. Nearly every cell in a person’s body has the same DNA.

f. As shown in Figure 1, DNA looks like an incredibly long twisted ladder. This shape is called a double helix. The sides of the ladder are a linked chain of alternating sugar and phosphate molecules (called the backbone). The rungs connected to the sugar molecules are known as bases.

Figure 1 A representation of DNA model

g. The DNA backbone is exactly the same in all people. On the other hand, the rungs are different in people.

h. Each rung is made up of two bases that link together. There are four bases - adenine (A), thymine (T), guanine (G) and cytosine (C). Because of their chemical nature, A will only link with T and G will only link with C (i.e. A-T; G-C). No base can join with itself (i.e. No A-A / T-T / G-G / C-C).

i. The order of the bases of DNA determines the information available for building and maintaining an organism. This order is referred to as genetic code.

j. Human DNA consists of about 3 billion bases, and more than 99 % of the base sequence in DNA is the same in all people. Less than 1 % is unique to each individual (except identical twins).

Lesson 8 DNA Fingerprinting

Worksheet 8.1 What is DNA?

1. Decide whether the following statements are TRUE or FALSE.

a. There are 46 pairs of chromosomes in the cell nucleus.

b. Chromosomes are made of DNA and proteins.

c. DNA determines the body characteristics of an organism.

d. DNA is extracted from red blood cells found in a blood sample.

e. The hair and teeth of the same person are composed of same DNA molecules.

f. Identical twins have different base sequences of DNA .

g. In the DNA structure, adenine (A) will only link with cytosine (C) and guanine (G) will only link with thymine (T).

Answers:

a. F

b. T

c. T

d. F

e. T

f. F

g. F

If the sequence on one strand of DNA is:

GATCCTCATA

What is the sequence on the other strand?

Answers:

GATCCTCATA

CTAGGAGTAT

Lesson 8 DNA Fingerprinting

Worksheet 8.2 DNA Extraction from strawberries

Objective of experiment:

To extract DNA from strawberries with a washing-up liquid

Apparatus and Materials (per group):

mortar x 1

pestle x 1

beaker x 1

test tube x 1

muslin cloth

funnel x 1

glass rod x 1

toothpick x 1

strawberry x 2

salt (1/2 teaspoon)

ice-cold alcohol (about 10mL)

washing-up liquid (about 10mL)

tap water (about 30mL)

ice

Procedures:

Grind strawberries with a pestle in the mortar.

2. Add about 10 mL washing-up liquid, 1/2 teaspoon salt and approximately 30 mL tap water to the grinded strawberries. Stir the mixture gently for 1 minute.

3. Filter the mixture through a muslin cloth into a test tube, about 1/3 full, to separate strawberries from the clear liquid.

4. Double up the volume of the mixture by adding alcohol slowly into the test tube.

5. Leave the mixture undisturbed for 2-3 minutes in an ice-bath until no emergence of bubbles.

6. Swirl a toothpick around the interface of the two layers formed inside the test tube. Long and stringy threads can be picked up.

Discussions:

1. Can we extract DNA from other plants, say, onion, kiwi fruit, broccoli, banana (without skin) with the same method? Why?

All the above plants have cells, and DNA is found in the nucleus. Therefore, we can extract DNA from the plants with the same method.

2. At a crime scene what forensic evidence can you collect for the extraction of DNA?

Blood, saliva, skin scalp, hair and etc. Because DNA is found in nearly every cell in the body. But one significant exception is red blood cells which lack nuclei.

Questions:

1. What is the purpose of grinding the strawberries?

To break down the cell wall, cellular membranes and nuclear membranes.

2. Where is the DNA of strawberries?

In the cell nucleus.

3. What is the function of the washing-up liquid (detergent) in step 2?

Soap dissolves cell membranes so that DNA is liberated.

4. What is the function of salt in step 2?

Salt solution helps the DNA strands come together.

5. What happens when alcohol is added to the solution in step 4?

DNA is soluble in water and will appear clear in water. But DNA is insoluble in non-polar solvent, such as alcohol. Therefore, DNA will precipitate (solidify and appear) out of alcohol. Of course, this is not pure DNA.

Sample output

Lesson 8 DNA Fingerprinting

Worksheet 8.3 Location and Sources of DNA at Crime Scene

Guess (i) the possible locations of DNA on the collected evidence from a crime scene and (ii) the possible sources of DNA.

Evidence / Possible locations of DNA on the
collected evidence / Possible sources of DNA
Eyeglasses / Ear pieces / Sweat, skin
Baseball bat / handle / Sweat, skin, blood
Facial tissue / Surface area / Mucus, blood, sweat, semen
Dirty laundry / Surface area / Blood, sweat, semen
Used cigarette / Cigarette butt / Saliva
Bottle, can, glass / Sides, mouthpiece / Saliva, sweat
Blanket, pillow, sheet / Surface area / Sweat, hair, semen, urine, saliva
Bite mark / Person’s skin / Saliva
Fingernail, partial fingernail / Scrapings / Blood, sweat, tissue

Lesson 8 DNA Fingerprinting

Worksheet 8.4 Restriction Enzymes

1. Restriction enzyme, EcoRI always cuts DNA at GAATTC as indicated below:

You are provided with the following DNA sample.

GTAAGAATTCTTTAGAATTCCGCCATTATCGAATTCAGGATCTTAC

CATTCTTAAGAAATCTTAAGGCGGTAATAGCTTAAGTCCTAGAATG

a. How many times does the specified base sequence GAATTC appear?

b. How many fragments would result from a restriction digestion of the DNA sample with the enzyme EcoRI?

c. List all the fragments formed.

2. Different restriction enzymes cut at different sites, two examples are listed below:

Enzyme / Cutting Site
HaeIII / GGCC /
Bam HI / GGATCC

Now, you are provided with the following DNA sample:

GTAGGATCCACGGAAGCT TGCAGGCCGCGAATTCAGGCCATA

CATCCTAGGTGCCT TCGAACGTCCGGCGCT TAAGTCCGGTAT

For each restriction enzyme,

a. How many times does cutting site appear?

b. How many fragments would result from a restriction digestion of the DNA sample with the enzyme?

c. List all the fragments formed.

Answers:

1. a. The sequence GAATTC appears three times in the DNA strand. As a result, the strand is cut into four pieces.

b. The fragments are as follows:

2. Cutting site for the enzyme Hae III reads:

a. The sequence GGCC appears twice in the DNA strand.

b. As a result, the strand is cut into three pieces.

c. The fragments are as follows:

For Bam HI GGATCC,

a. The sequence GGATCC appears once in the DNA strand.

b. As a result, the strand is cut into two pieces.

c. The fragments are as follows:

As a result, the DNA of an organism is cut up into fragments using restriction enzymes. A large number of short fragments of DNA will be produced.

Lesson 8 DNA Fingerprinting

Worksheet 8.5 DNA fingerprint Analysis

1. A child inherits one set of chromosomes from each parent. This is why children carry characteristics from both of their parents. A child who has mom with brown hair and blue eyes and dad with blond hair and brown eyes might end up with brown hair from his mom and brown eyes from his dad.

The Chan’s family consists of mom, dad and four kids. The parents have one daughter and one son together, the other daughter is from the mother’s previous marriage, and the other son is adopted. Here are the DNA analysis results:

Answer the following questions:

a. Which child is adopted?

b. Which child is from the mother’s previous marriage?

c. Who are the own children of Mr and Mrs Chan?

In all cases, make use of DNA profile to explain your answers briefly.

2. There was a murder case. A blood sample from a crime scene was collected. DNA samples of the victim and the potential suspects (June, Scarlet and John) were collected for DNA analysis. The DNA profile is shown below. Now, you should be able to identify the potential murderer.

Answers:

1. You can distinguish the parents of the children by looking at the position of the bands in the DNA profile.

Child 2 is the child from the mother’s previous marriage and Child 4 is adopted. You can see that both Child 1’s and Child 3’s DNA fragments match with both of the mom and dad, while Child 2’s DNA fragments match with the mom but not the dad, and Child 4’s DNA fragments do not match with either parent.

2. a. All of the DNA fragments (5, 7, 10, 13) found in the victim are present in the sample from the crime scene.

b. John’s DNA fragments (10 and 7) are of the same size as those DNA fragments in the crime scene. However, his other fragments (6, 4 and 3) are missing in the crime scene sample, allowing him to be ruled out as a suspect.

c. June’s DNA fragments (8 and 12) are of the same size as those DNA fragments in the crime scene. However, her other fragments (1 and 19) are missing in the crime scene, allowing her to be ruled out as a suspect, too.

d. All of the DNA fragments (18, 12, 8 and 2) of Scarlet can be found in the crime scene sample, thus making her the most likely suspect.

Extended discussion:

1. June and Scarlet have the same DNA fragments (8 and 12). What are the possible implications?

Ans: This pattern may arise if the two women are related or if this pattern were common in the population.

2. Why DNA evidence must be combined with the traditional forms of evidence such as eyewitness accounts?

Ans: Someone’s DNA is found at a crime scene does not mean that they committed the crime because of the following reasons:

(i) The DNA sample may be contaminated by the environment.

(ii) The sample may be a mixture of more than one person’s DNA.

(iii) The DNA evidence may be degraded or broken down.

Lesson 8 DNA Fingerprinting

Worksheet 8.6 Group discussion

Do white blood cells give more accurate test result for paternity than cheek cells?

2. What are the legal and ethical issues on the use of DNA fingerprinting in society?

3. DNA fingerprinting can be used to convict someone of a crime. What would be the difficulty in using this technique to identify criminals if the suspects were father and son? Twin brothers?

4. Other than forensic science, list out the other uses of DNA analysis. Describe each use briefly.