Online Resource
Intestinal toxicity of the masked mycotoxin deoxynivalenol-3-β-D-glucoside
Archive of Toxicology
Alix Pierron1,2,3* and Sabria Mimoun1,2*, Leticia S. Murate1,2,4, Yannick Lippi1,2, Nicolas Loiseau1,2, Ana-Paula F.L. Bracarense4, Laurence Liaubet5,6,7, Gerd Schatmayr3, Frantz Berthiller8, Wulf-Dieter Moll3 and Isabelle P. Oswald1,2
1 INRA, UMR 1331, Toxalim, Research Center in Food Toxicology, Toulouse, France
2 Université de Toulouse, INP, UMR 1331, Toxalim, Toulouse, France
3 BIOMIN Research Center Technopark 1, 3430 Tulln, Austria
4 Universidade Estadual de Londrina, Lab. Patologia Animal, CP 6001, Londrina, Brazil
5 INRA, UMR1388 Génétique, Physiologie et Systèmes d'Elevage, F-31326 Castanet-Tolosan, France.
6 Université de Toulouse INPT ENSAT, UMR1388 Génétique, Physiologie et Systèmes d'Elevage, F-31326 Castanet-Tolosan, France.
7 Université de Toulouse INPT ENVT, UMR1388 Génétique, Physiologie et Systèmes d'Elevage, F-31076
8 Christian Doppler Laboratory for Mycotoxin Metabolism and Center for Analytical Chemistry, Department for Agrobiotechnology (IFA-Tulln), University of Natural Ressources and Life Sciences, Vienna, Austria
* equally contributed
Address correspondence to
Dr Isabelle P. Oswald
INRA, UMR-1331, Toxalim, 180 chemin de Tournefeuille, 31027 Toulouse cedex 3, France
Phone +33 582066366
E-Mail:
ESM_ 1: Supplemental Material and methods
Caco-2 cell culture
The human epithelial colorectal adenocarcinoma cells Caco-2 (passages 99 - 106) obtained from the TC7 were used. Cells were maintained in a humidified atmosphere of 90% air and 5% CO2 at 37°C. Medium was refreshed every 2 days and cells were passaged one a week. Cells were trypsinized using Trypsin –Versene (EDTA, Eurobio) and were diluted in culture medium. Caco-2 cells were spontaneously differentiated from confluent monolayer after 21 days of culture with medium changed every 2 days (Sambuy et al. 2005; Pinton et al 2012).
Cell viability assay
Cell viability assay were performed with the CellTiter-Glo Luminescent Cell Viability (Promega, Madison, USA). Cells were seeded at the density of 1.56.105cells/cm² in 96-well microtiter plates (surface area 0.28cm²) (Greiner bio-one, Vilvoorde, Belgique).
For proliferating cells, after 24 hours of incubation, cells were exposed for 48 hours at different doses of diluents (DMSO) or toxins: DON or D3G. For differentiating cells, cell viability assay was performed after 21 days of differentiation and cells were exposed for 8 days at different doses of diluents (DMSO) or toxins: DON or D3G.
Luminescence was measured with a spectrophotometer (TECAN Infinite M200, Männedorf, Switzerland).
Trans-epithelial electrical resistant measurement
Cells (1.34x105cells/cm² of seeding) were grown until complete differentiation on polyethylene terephtalate membrane inserts (surface area 0.3 cm2, pore size 0.4 µm) in 24-well format (Becton Dickinson, Pont de Claix, France). Medium was changed every two days. Differentiated cells were exposed to 10µM of DMSO, DON or D3G. The culture medium in apical side of differentiated cells in each well was replaced every two days with medium containing toxin. The TEER was measured for each well daily during 8days using a Millicell-ERS Voltohmmeter (Millipore, Saint-Quentin-en-Yvelines, France). TEER values were expressed as kΩ×cm2.
Immunoblotting
Caco2 cells differentiated on 24-well format (same process that for TEER), were treated with 10 µM of DMSO for control, D3G or DON for 1 hour to analyze the expression of the total and phosphorylated MAPK P38 and JNK. Proteins were extracted from cells as previously described (Pinton et al. 2009) quantified and 15 µg of total proteins was separated by SDS-PAGE. The membranes were probed with rabbit antibodies (Cell Signaling Technology, Danvers, USA) specific for: SAPK/JNK and phospho-SPAK/JNK or p38 and phospho-p38 diluted at 1:500 or GAPDH diluted at 1:1000. After washing, the membranes were incubated with 1:10,000 CFTM770 goat anti-rabbit IgG (Biotium, Hayward, USA) for the detection. Antibody detection was performed using an Odyssey Infrared Imaging Scanner (Li-Cor Science Tec, les Ulis, France) with the 770nm channel. The expression of the proteins was estimated after normalization with GAPDH signal. Three independent experiments were proceeding for each cell culture condition.
Intestinal jejunal explants, preparation for microarray analysis
The microarray GPL16524 (Agilent technology, 8 x 60K) used in this experiment consisted in 43,603 spots derived from the 44K (V2:026440 design) Agilent porcine specific microarray, 9,532 genes from adipose tissue, 3,776 genes from immune system and 3,768 genes from skeletal muscle (Voillet et al. 2014). For each sample, Cyanine-3 (Cy3) labeled cRNA was prepared from 200 µg of total RNA using the One-Color Quick Amp Labeling kit (Agilent) according to the manufacturer's instructions, followed by Agencourt RNAClean XP (Agencourt Bioscience Corporation, Beverly, Massachusetts). About 600ng of Cy3-labelled cRNA was hybridized on SurePrint G3 Porcine GE microarray (8X60K) following the manufacturer’s instructions. Slides were scanned immediately after washing on an Agilent G2505C Microarray Scanner with Agilent Scan Control A.8.5.1 software. All experimental details are available in the Gene Expression Omnibus (GEO) database under accession GSE66918 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=olixoosedvmdnqr &acc=GSE6691 8). Microarray data from Feature Extraction software was analyzed with R (www.r-project.org, R v. 3.0.1), using Bioconductor packages (www.bioconductor.org, v 2.12, ((Gentleman et al. 2004).
Statistical Analysis
For microarray data, statistical analysis was performed with R 3.0.1 software. The limma package (Ritchie et al. 2015) was used to analyze differences between treatments. A model including animal explants pairs were fitted using the limma lmFit function (Smyth 2004). A correction for multiple testing was then applied using False Discovery Rate (Benjamini and Hochberg. 1995). Probes with adjusted p-value ≤ 0.05 were considered differentially expressed between treated and control conditions. Hierarchical clustering was applied to the samples and the probes using 1-Pearson correlation coefficient as distance and Ward’s criterion for agglomeration.
ESM_2 : Table of primer sequences used for RT-qPCR analysis (F: Forward; R: Reverse)
Gene symbol / Gene name / Primer sequence / ReferencesCycloA / Cyclophilin A / F: CCCACCGTCTTCTTCGACAT / NM_214353
R: TCTGCTGTCTTTGGAACTTTGTCT / (Curtis et al. 2009)
RPL32 / Ribosomal Protein L32 / F: AGTTCATCCGGCACCAGTCA / NM_001001636
R: GAACCTTCTCCGCACCCTGT / (Pinton et al. 2010)
IL-1α / Interleukin 1- alpha / F: TCAGCCGCCCATCCA / NM_214029,1
R: AGCCCCCGGTGCCATGT / (Cano et al. 2013)
IL-1β / Interleukin 1- beta / F: ATGCTGAAGGCTCTCCACCTC / NM_214055
R: TTGTTGCTATCATCTCCTTGCAC / (von der Hardt et al. 2004)
IL8 / Interleukin 8 / F: GCTCTCTGTGAGGCTGCAGTTC / NM_213867
R: AAGGTGTGGAATGCGTATTTATGC / (Grenier et al. 2011)
TNF-α / Tumor necrosis factor -alpha / F: ACTGCACTTCGAGGTTATCGG / NM_214022
R: GGCGACGGGCTTATCTGA / (Meissonnier et al. 2008)
IL-17α / Interleukin 17- alpha / F: CCAGACGGCCCTCAGATTAC / AB102693
R: CACTTGGCCTCCCAGATCAC / (Cano et al. 2013)
IL22 / Interleukin 22 / F: AAGCAGGTCCTGAACTTCAC / AY937228
R: CACCCTTAATACGGCATTGG / (Cano et al. 2013)
https://secure.yazibadrive.net/my/FileLink/f49e17bf-43e3-0286-d255-243243c707f9/false
ESM_3 : Video of DON inside the A-site of the ribosome 60S subunit
P and A sites of the ribosome 60S subunit are respectively in purple and yellow, the 3-hydroxyl group of DON is represented in red and the atom of magnesium in green, in CPK representation. Video shows a 360° view of the binding of the DON inside the A-site of the ribosome 60S subunit.
https://secure.yazibadrive.net/my/FileLink/bfb9d494-c401-7764-1020-04cfc5fef3e7/false
ESM_4 : Video of D3G inside the A-site of the ribosome 60S subunit
P and A sites of the ribosome 60S subunit are respectively in purple and yellow, the 3-hydroxyl group of DON is represented in red and the atom of magnesium in green, in CPK representation. Video shows a 360° view of the interaction model of the D3G inside the A-site of the ribosome 60S subunit after alignment of the backbone of D3G over the DON.
References
· Benjamini HY and Hochberg Y (1995) Controlling the False Discovery Rate: a practical and powerful approach to multiple testing. J R Statist Soc B. 57:289-300
· Cano PM, Seeboth J, Meurens F, Cognie J, Abrami R, Oswald IP and Guzylack-Piriou L (2013) Deoxynivalenol as a new factor in the persistence of intestinal inflammatory diseases: an emerging hypothesis through possible modulation of Th17-mediated response. PLoS One 8:e53647
· Curtis MM, Way SS and Wilson CB (2009) IL-23 promotes the production of IL-17 by antigen-specific CD8 T cells in the absence of IL-12 and type-I interferons. J Immunol. 183:381-387
· Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, Ellis B, Gautier L, Ge Y, Gentry J, Hornik K, Hothorn T, Huber W, Iacus S, Irizarry R, Leisch F, Li C, Maechler M, Rossini AJ, Sawitzki G, Smith C, Smyth G, Tierney L, Yang JY and Zhang J. (2004) Bioconductor: open software development for computational biology and bioinformatics. Genome Biol. 5:R80
· Grenier B, Loureiro-Bracarense AP, Lucioli J, Pacheco GD, Cossalter AM, Moll WD, Schatzmayr G and Oswald IP. (2011) Individual and combined effects of subclinical doses of deoxynivalenol and fumonisins in piglets. Mol Nutr Food Res. 55:761-771
· Meissonnier GM, Pinton P, Laffitte J, Cossalter AM, Gong YY, Wild CP, Bertin G, Galtier P and Oswald IP. (2008) Immunotoxicity of aflatoxin B1: impairment of the cell-mediated response to vaccine antigen and modulation of cytokine expression. Toxicol Appl Pharmacol. 231:142-149
· Pinton P, Braicu C, Nougayrede JP, Laffitte J, Taranu I and Oswald IP (2010) Deoxynivalenol Impairs Porcine Intestinal Barrier Function and Decreases the Protein Expression of Claudin-4 through a Mitogen-Activated Protein Kinase-Dependent Mechanism. J Nutr. 140:1956-1962
· Pinton P, Nougayrède JP, Del Rio JC, Moreno C, Marin DE, Ferrier L, Bracarense AP, Kolf-Clauw M and Oswald IP. (2009) The food contaminant deoxynivalenol, decreases intestinal barrier permeability and reduces claudin expression. Toxicol Appl Pharmacol. 237:41-48
· Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W and Smyth GK (2015) limma powers differential expression analyses for RNA-sequencing and microarray studies Nucleic Acids Res. 43:e47.
· Sambuy Y, De Angelis I, Ranaldi G, Scarino ML, Stammati A and Zucco F (2005) The Caco-2 cell line as a model of the intestinal barrier: influence of cell and culture-related factors on Caco-2 cell functional characteristics. Cell Biol Toxicol. 21:1-26
· Smyth GK (2004) Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol. 3:Article3
· Voillet V, San Cristobal M, Lippi Y, Martin PG, Iannuccelli N, Lascor C, Vignoles F, Billon Y, Canario L and Liaubet L (2014) Muscle transcriptomic investigation of late fetal development identifies candidate genes for piglet maturity. BMC Genomics. 15:797
· von der Hardt K, Kandler MA, Fink L, Schoof E, Dötsch J, Brandenstein O, Bohle RM and Rascher W (2004) High frequency oscillatory ventilation suppresses inflammatory response in lung tissue and microdissected alveolar macrophages in surfactant depleted piglets. Pediatr Res. 55:339-346