In Vitro Antigen-Presentation Assay

Supplemental Methods

In vitro antigen-presentation assay

BM-DCs were infected with MvP728 harboring OVA-expressing fusion plasmids. B3Z T-cells were added and co-cultured with a DC:T cell-ratio ranging from 1:8 to 8:1 in a total volume of 200 µl per well for 24 h. Cells were centrifuged and lysed by addition of 100 µl substrate solution (0.15 mM chlorophenyl red β-galactopyranoside, 0.5% (v/v) Nonidet P-40 in PBS). After incubation for 6 - 8 h at 37°C, the absorbance was determined at 595 nm using Infinity M200 plate reader (Tecan).

Quantification of Chemokines and Cytokines in Serum and Tumor Tissues

The tumor was surgically removed and a tumor extract was prepared in T-per extraction buffer supplemented with protease inhibitor cocktail (Pierce).Ten milliliters of buffer was used per gram of tumor sample. Supernatants were kept frozen at -80oC until analyzed. Blood was taken from the animal and serum samples were kept in -80oC until analyzed. The concentrations of cytokines and chemokines were analyzed with Milliplex MCYTOMAG-70K kit (Millipore) by the Luminex-200 assay following the manufacturer’s instructions.

Generation of Plasmids

Salmonella enterica serovar Typhimurium purD htrA double-deficient strainMvP728 was used as an attenuated carrier strain. For the generation of recombinant plasmids, E. coli DH5α was used as a host. Plasmids were introduced into Salmonella strains by electroporation and recombinant strains were cultured in media containing 50 µg/ml carbenicillin in order to maintain the plasmids. For generation of expression cassettes with gene fusions consisting of sseJ under control of SPI2 promoter PsifB, plasmid PsseAsseJ::OVA::HA (p3631) was digested with KpnI and EcoRI and ligated to amplified SifB promoter which digested from PsifB::sscBsseF::OVA::HA (p3528) obtaining plasmid PsifB::sseJ::OVA (p3643). Plasmids PsseA::steC::OVA::HA (p3634), PsseJ::sseJ::OVA::HA (p3554) or PsifA::sifA::OVA::HA (p3556) were digested with KpnI and EcoRI, the large fragment was ligated to amplified SseJ, sifA and sifB promoter separately forobtaining a combination plasmid.

For generation of expression cassette consisting of gene fusion codon-optimized human survivin (CO-SVN) or lisA (Llo), Plasmid harboring PsseA::sscB sseF::CO-SVN::HA (p3342Max) or PsseA::sseF::lisA::HA (p2810) was digested with EcoRV and XbaI, the small fragment was ligated to digested PsifB::sseJ::OVA (p3643) resulting in plasmid PsifB::sseJ::CO-SVN::HA (p8032) or PsifB::sseJ::lisA::HA (p8011). All the plasmids are confirmed with colony PCR, diagnostic digestion and sequenced using T3-Seq and T7-Seq.

Sequence of codon-optimized human survivin cDNA

GGCGCGCCGACCCTGCCGCCGGCGTGGCAGCCGTTCCTGAAAGACCACCGTATCTCTACCTTCAAAAACTGGCCGTTCCTGGAAGGCTGCGCGTGCACCCCGGAACGTATGGCGGAAGCGGGCTTCATCCACTGCCCGACCGAAAACGAACCGGACCTGGCGCAGTGCTTCTTCTGCTTCAAAGAACTGGAAGGCTGGGAACCGGACGACGACCCGATCGAAGAACACAAAAAACACTCTTCTGGCTGCGCGTTCCTGTCTGTTAAAAAACAGTTCGAAGAACTGACCCTGGGCGAATTCCTGAAACTGGACCGTGAACGTGCGAAAAACAAAATCGCGAAAGAAACCAACAACAAAAAAAAAGAATTCGAAGAAACCGCGAAAAAAGTTCGTCGTGCGATCGAACAGCTGGCGGCGATGGACTACCCGTACGACGTTCCGGACTACGCGTAA

Tumor models and therapy in mice

Cohorts of 6 - 8 mice were subcutaneously (s.c.) transplanted with CT26 or A20 cells (105 cells per mouse) and 5 days later were treated with orogastric application of 108 CFU per mouse of Salmonella MvP728 harboring an empty vector or an experimental plasmid as described (7). Booster immunizations were applied at weekly intervals. When indicated, a NKT-cell ligand 7DW8-5 (kindly provided by Dr. Tsuji, Alert Einstein College of Medicine, New York) was administrated intraperitoneally (i.p., 0.5 µg per mouse) at the time of primary vaccination. When indicated, 200 μg hamster anti-mouse CXCR3 mAb (clone CXCR3-173, Biolegend) or matched isotype control mAb (clone HTK888, Biolegend) was i.p. injected one day before the primary vaccination and repeated twice with weekly intervals. To deplete CD8, CD4, or NK cells, mice were i.p. injected with 200 µg anti-CD8 mAb (clone 2.43, ATCC), anti-CD4 mAb (clone GK1.5, ATCC), or 50 µg anti-asialo-GM1 anti-serum (Wako) one day before the primary vaccination and every 3 days thereafter for 3 weeks. Tumor growth was monitored by caliper measurement every two days. Total tumor volume was calculated by the formula: volume = (width)2×length/2.

Flow cytometry

After red blood cell lysis, cells were stained with PE-labeled H-2Kd/LLO91-99 Pro5 pentamer, FITC rat anti-mouse CD8 KT15 mAb (Proimmune), Pacific Blue rat anti-mouse CD3e, and APC-Cy7 rat anti-mouse-CD19 (BD Biosciences). To obtain tumor-infiltrating leukocytes for FACS analysis, resected tumor tissues were homogenized to single-cell suspensions and subjected to Percol gradient density centrifugation. The obtained cells were stained with Pacific Blue anti-CD3,APC-Cy7 anti-CD8, PE-Cy7 anti-CD4, PerCP anti-DX5,PerCP anti-CD25, FITC anti-CD69,APC anti-CXCR3, FITC anti-CD11c, APC anti-CD80, PerCP anti-CD86 (Biolegend) and intracellularly with Alexa-647 anti-FoxP3 (BD Biosciences). Cell viability was determined by Aqua Dead Cell Stain Kit (Life Technologies).Fluorochrome- and isotype-matching mAbs were used as negative controls. For NKT cell analysis we used PE-mCD1d/PBS-57 tetramer or control PE-mCD1d tetramer (NIH Tetramer Core Facility).