Identification of Quantitative Trait Loci for Grain Size and the Contributions of Major Grain Size QTLsto Grain Weight in Rice
Liang Sun1, Dapeng Ma1, Huihui Yu2, Fasong Zhou2, Yibo Li1, Lijun Luo3,Guanjun Gao1, Qinglu Zhang1, Caiguo Xu1and Yuqing He1*
1National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan) and National Center of Crop Molecular Breeding, Huazhong Agricultural University, Wuhan 430070, China
2 Life Science and Technology Center, China National Seed Group Co., Ltd., Wuhan 430075, China
3 Shanghai Agrobiological GeneCenter, Shanghai 201106, China
*Corresponding author (E-mail: ; phone: +86-27-87281689)
SupplementaryTables
SupplementaryTable1 Sequence Primers mentioned in our study
Sequence Primers / Forward primer / Reverse primerC62 / GATTGACTGATAAATTGACAGC / CTAACTCCCATGGAATTAC
C88 / GTGGAGCGAGAGAGGTCACTG / CTAACGGATGTGGATTATCTG
Indel_M2 / GCGTCGTCAGAGGTAGA / GACCTAACCCATCTCATTCCA
N1212 / CGTCTTGCAACCAACGCCGATGTTATAC / GAGCGTGTGTAGGGAAGGAGCTGCATGA
SupplementaryTable 2 Performances of 4 traits in F2 populationderived from the combined QTLs-NIL
Trait / parents(mean±SD) / Population rangeZhenshan 97 / SLG / Minghui 63
KGW (g) / 25.1±0.51 / 41.5±0.78 / 28.6±0.53 / 19.7-44.5
GL (mm) / 8.17±0.08 / 12.3±0.09 / 9.9±0.07 / 8.2-11.9
GW (mm) / 3.19±0.02 / 3.87±0.04 / 2.82±0.03 / 2.83-4.67
GT (mm) / 2.05±0.04 / 2.38±0.08 / 2.13±0.06 / 1.82-2.49
SupplementaryFigures
SupplementaryFig.1 Strategy for the development of the F2 population.
SupplementaryFig.2 The genetic background of the three combined QTLs-NILs.The genotype was assigned to “BB” if the detected SNP marker of the NIL was homozygous and different from Zhenshan 97; the genotype was assigned to “H” if the marker of NIL were heterozygous and the correspondent one of Zhenshan 97 was homozygous; if a locus is neither “BB” nor “H” SNP types, it was assigned “AA”.
Supplementary Fig.3 The distribution of RILs population in both two years.
a, b, c and d was represented to the distribution of GL,GW, GT and KGW,respectively.Black arrow and white arrow represented SLG and Zhenshan 97. Blackbars and white bars represented phonotype in 2003 and 2004.
Supplementary Fig.4 Phenotype compare between the 7 types and CKs of F2 populationderived from the combined QTLs-NIL.
All data are given as mean ±SD; *P < 0.05, **P < 0.01, ***P < 0.001
Line(qGL3) represents individuals were homozygous with respect to SLG allele in qGL3 buthomozygous with respect to Zhenshan 97 allele in both qGW2a and qGS5; line(qGW2a) represents individuals were homozygous with respect to SLG allele in qGW2a but homozygous with respect to Zhenshan 97 allele in both qGL3 and qGS5; line(qGS5) represents individuals were homozygous with respect to Minghui 63 allele in qGS5 but homozygous with respect to Zhenshan 97 allele in both qGW2a and qGL3; line(qGW2a/qGL3) represents individuals were homozygous with respect to SLG allele in both qGL3 and qGW2abut homozygous with respect to Zhenshan 97 allele in qGS5; line(qGL3/qGS5) represents individuals were homozygous with respect to SLG allele in qGL3 also homozygous with respect to Minghui 63 allele in qGS5 but homozygous with respect to Zhenshan 97 allele in qGW2a; line(qGW2a/qGS5) represents individuals were homozygous with respect to SLG allele in qGW2a also homozygous with respect to Minghui 63 allele in qGS5 but homozygous with respect to Zhenshan 97 allele in qGL3; line(qGL3/qGW2a/qGS5) represents individuals were homozygous with respect to SLG allele in qGL3 and qGW2a also homozygous with respect to Minghui 63 allele in qGS5.