Identification of Potential Microrna-Target Pairs Associated with Osteopetrosis by Deep

Identification of potential microRNA-target pairs associated with osteopetrosis by deep sequencing, iTRAQ proteomics and bioinformatics

Minglin Ou1, M.D.; Xiaoqing Zhang1, M.D.; Yong Dai1, Ph.D.; Jieying Gao1, Ph.D.; Mingsong Zhu1, M.S.; Xiangchun Yang1, M.S.; Yuchao Li1, M.D.; Ting Yang1, M.S.; Min Ding1*, M.D.

1 Key Laboratory of Laboratory Medical Diagnostics, Ministry of Education, Chongqing Medical University, Chongqing, 400016, China.

* Correspondance should be addressed to Min Ding. E-mail: ; Telephone: +86-023-68485239; Fax: +86-023-68485992.

SUPPLEMENTARY METHODS

iTRAQ LC-MS-MS Analysis

One hundred micrograms of protein from each corresponding group pooled protein was digested with trypsin, and labeled according to the iTRAQ protocol (Applied Biosystems, Foster City, CA, USA). The labeled digests were combined into one sample mixture and reconstituted with 4 mL buffer A (25mM NaH2PO4 in 25% ACN, pH2.7). The fractionation was performed using LC-20AB HPLC Pump system (Shimadzu, Kyoto, Japan). The peptide in buffer A was loaded onto a 4.6 × 250 mm Ultremex SCX column containing 5-μm particles (Phenomenex, Torrance, CA, USA). The peptides is eluted at a flow rate of 1 mL/min with a gradient of buffer A for 10 min, 5-35% buffer B (25mM NaH2PO4, 1M KCL in 25% ACN, pH2.7) for 11 min, 35-80% buffer B for 1 min. The system was then maintained in 80% buffer B for 3 min before equilibrating with buffer A for 10 min prior to the next injection. Elution is monitored by measuring absorbance at 214 nm, and fractions are collected every 1 min. The eluted peptides are pooled as 12 fractions, desalted by Strata X C18 column (Phenomenex, Torrance, CA, USA) and vacuum-dried. Each fraction was resuspended in certain volume of mobile phase A (2% ACN, 0.1% FA) and centrifuged at 20000g for 10min. The final average concentration of peptide in each fraction was 0.25μg/μL. The peptide was then loaded on a splitless nanoACQuity (Waters, Milford, MA, USA) system coupled to the Triple TOF for analytical separation. Data acquisition was performed with a TripleTOF 5600 System (AB SCIEX, Concord, ON) fitted with a Nanospray III source (AB SCIEX, Concord, ON) and a pulled quartz tip as the emitter (New Objectives, Woburn, MA, USA). The MS data were processed using Proteome Discoverer Software (Version 1.2.0.208) (Thermo Scientific, Bremen, Germany) to generate the peak list. Mascot 2.3.02 (Matrix Science, London, United Kingdom) was used for the protein identification, and the parameters as follows: Type of search: MS/MS Ion search; Enzyme: Trypsin; Fragment mass tolerance: ±0.1 Da; Mass values: Monoisotopic; Variable modifications: Gln->pyro-Glu (N-term Q), Oxidation (M), iTRAQ8plex(Y); Peptide mass tolerance: 0.05 Da; Instrument type: Defult; Max missed cleavages: 1; Fixed modifications: arbamidomethyl (C), iTRAQ8plex (N-term), iTRAQ8plex (K); Protein Mass: Unrestricted; Other parameters: default; Database, IPI_human v3.87 (91464 sequences). The search results were further filtered with the parameters as follows: for protein identification, significance threshold: P0.05 (with 95% confidence), ion score or expected cutoff < 0.05 (with 95% confidence); for protein quantitation, protein ratio type: weighted; minimum precursor charge: 1; minimum peptides: 2 (unique peptides); median intensities: normalization (removed outliers automatically). Proteins with 1.5 fold or more change between osteopetrosis group and the control group were determined as differentially expressed proteins.

Calculation of Pi, Pm1, Pc, and Pm2

The proportion of inversely expressed miRNA and protein pairs that were computationally predicted in the two sample groups was calculated as Pi=ni/Ni, where ni was the number of inversely expressed miRNA and protein pairs that were computationally predicted, and Ni was the total number of computationally predicted miRNA and protein pairs; eight miRNAs were randomly selected from the 411 miRNAs found by deep sequencing, the proportion of inversely expressed miRNA and protein pairs that were randomly selected was calculated as Pm1 =nm1/Nm1, where nm1 was the number of inversely expressed miRNA and protein pairs that were randomly selected, Nm1 was the total number of randomly selected miRNA and protein pairs. Similarly, The proportion of computationally predicted miRNA and protein pairs that were inversely expressed was calculated as Pc=nc/Nc, where nc was the number of computationally predicted miRNA and protein pairs that were inversely expressed, and Nc was the total number of inversely expressed miRNA and protein pairs; the proportion of computationally predicted miRNA and protein pairs that were randomly selected was calculated as Pm2 =nm2/Nm2, where nm2 was the number of computationally predicted miRNA-target pairs that were randomly selected, Nm2 was the total number of randomly selected miRNA and protein pairs.

SUPPLEMENTARY TABLES

Table S1 miRNAs differentially expressed between osteopetrosis and controls

Name / Health control-std / Osteopetrosis-std / Fold-change (log2osteopetrosis/ control) / p-value
hsa-let-7g-5p / 40817.5375 / 16830.7834 / -1.27809 / 0
hsa-let-7i-3p / 0.4912 / 1.9056 / 1.955863 / 0.003200961
hsa-let-7i-5p / 7762.5824 / 3827.5687 / -1.02011 / 0
hsa-miR-122-5p / 0.2947 / 1.4292 / 2.277889 / 0.00541727
hsa-miR-1255a / 11.5925 / 5.3358 / -1.11942 / 7.96E-07
hsa-miR-1255b-5p / 2.5543 / 6.3839 / 1.32151 / 3.31E-05
hsa-miR-125a-5p / 27.606 / 12.6725 / -1.12328 / 1.97E-14
hsa-miR-125b-5p / 5.0103 / 2.2868 / -1.13157 / 0.001113768
hsa-miR-1260b / 0.0982 / 1.6198 / 4.043949 / 9.89E-05
hsa-miR-1262 / 1.6701 / 0.3811 / -2.13169 / 0.003473324
hsa-miR-1270 / 3.7332 / 0.9528 / -1.97017 / 2.43E-05
hsa-miR-1277-5p / 8.0558 / 1.9056 / -2.07978 / 9.92E-11
hsa-miR-1306-5p / 0.8842 / 3.8113 / 2.107839 / 9.18E-06
hsa-miR-1307-5p / 10.1189 / 42.4957 / 2.070264 / 8.67E-50
hsa-miR-130b-3p / 33.7952 / 70.6039 / 1.06293 / 1.45E-31
hsa-miR-130b-5p / 2.2596 / 0.9528 / -1.24582 / 0.019231005
hsa-miR-136-5p / 11.4943 / 1.2387 / -3.21402 / 4.71E-23
hsa-miR-139-5p / 17.9783 / 43.925 / 1.288786 / 6.28E-27
hsa-miR-142-3p / 91.7579 / 45.5447 / -1.01055 / 1.44E-37
hsa-miR-143-5p / 4.1262 / 12.4819 / 1.596952 / 1.95E-11
hsa-miR-148b-5p / 9.6277 / 3.9066 / -1.30128 / 4.11E-07
hsa-miR-150-3p / 105.2171 / 34.3015 / -1.61703 / 4.49E-87
hsa-miR-150-5p / 159.5448 / 424.5761 / 1.412062 / 1.24E-281
hsa-miR-151b / 2.2596 / 0.8575 / -1.39786 / 0.010567239
hsa-miR-152 / 425.9768 / 180.4639 / -1.23906 / 2.28E-232
hsa-miR-1537 / 1.8666 / 0.5717 / -1.70708 / 0.007453647
hsa-miR-15b-5p / 90.186 / 354.4486 / 1.974601 / 0
hsa-miR-16-1-3p / 1.1789 / 0.0953 / -3.62882 / 0.001518444
hsa-miR-16-5p / 550.4493 / 1388.7335 / 1.335088 / 0
hsa-miR-193a-5p / 2.9473 / 10.5763 / 1.843369 / 8.71E-12
hsa-miR-193b-5p / 13.8521 / 3.6207 / -1.93576 / 4.98E-16
hsa-miR-197-3p / 2.9473 / 8.1942 / 1.475209 / 3.07E-07
hsa-miR-199b-5p / 3.7332 / 10.7669 / 1.528118 / 1.63E-09
hsa-miR-19a-3p / 1.7684 / 0.4764 / -1.8922 / 0.005276565
hsa-miR-204-3p / 0.5895 / 2.0962 / 1.830213 / 0.003020198
hsa-miR-20b-3p / 7.2699 / 2.4773 / -1.55317 / 5.13E-07
hsa-miR-21-3p / 6.091 / 1.8104 / -1.75037 / 5.73E-07
hsa-miR-21-5p / 9243.4805 / 3804.0341 / -1.28091 / 0
hsa-miR-221-5p / 230.9667 / 532.6258 / 1.205437 / 1.24E-276
hsa-miR-223-5p / 149.0329 / 51.3569 / -1.537 / 6.08E-114
hsa-miR-23a-3p / 460.3615 / 2079.4319 / 2.17535 / 0
hsa-miR-23b-3p / 40.5739 / 136.0625 / 1.745646 / 4.97E-124
hsa-miR-24-3p / 423.226 / 919.4702 / 1.119375 / 0
hsa-miR-25-5p / 196.8767 / 88.231 / -1.15793 / 1.33E-97
hsa-miR-28-5p / 24.1675 / 11.815 / -1.03245 / 2.32E-11
hsa-miR-296-5p / 0.1965 / 2.5726 / 3.710626 / 1.29E-06
hsa-miR-299-5p / 0.5895 / 2.5726 / 2.125663 / 0.000274089
hsa-miR-29a-5p / 1.6701 / 0.5717 / -1.5466 / 0.018593522
hsa-miR-29b-3p / 202.28 / 52.8814 / -1.93552 / 2.68E-212
hsa-miR-30a-3p / 3.9297 / 1.6198 / -1.2786 / 0.001509335
hsa-miR-30a-5p / 36.6442 / 13.4347 / -1.44762 / 5.95E-27
hsa-miR-30e-5p / 198.1539 / 60.8851 / -1.70246 / 1.41E-174
hsa-miR-3141 / 1.8666 / 0.667 / -1.48465 / 0.0154627
hsa-miR-3174 / 0.5895 / 1.7151 / 1.540729 / 0.017997257
hsa-miR-3200-5p / 0.1965 / 1.0481 / 2.415175 / 0.015124182
hsa-miR-3202 / 4.9121 / 1.2387 / -1.98751 / 1.03E-06
hsa-miR-320a / 31173.1319 / 9897.9779 / -1.6551 / 0
hsa-miR-32-5p / 10.6101 / 2.7632 / -1.94103 / 1.20E-12
hsa-miR-331-3p / 0.7859 / 11.6244 / 3.886667 / 7.78E-27
hsa-miR-337-3p / 0.2947 / 1.8104 / 2.61899 / 0.000634491
hsa-miR-337-5p / 0.2947 / 1.2387 / 2.071508 / 0.01512505
hsa-miR-339-5p / 5.5015 / 12.7678 / 1.214613 / 3.46E-08
hsa-miR-33a-5p / 143.3349 / 35.7307 / -2.00415 / 4.50E-158
hsa-miR-342-5p / 124.3742 / 48.1174 / -1.37006 / 1.43E-80
hsa-miR-34c-5p / 6.3857 / 1.9056 / -1.7446 / 3.23E-07
hsa-miR-3613-3p / 0.9824 / 2.1915 / 1.157536 / 0.030497805
hsa-miR-363-5p / 6.091 / 2.1915 / -1.47476 / 9.92E-06
hsa-miR-365b-5p / 5.4033 / 1.6198 / -1.73803 / 2.84E-06
hsa-miR-3690 / 8.8418 / 28.5846 / 1.692826 / 2.69E-26
hsa-miR-369-5p / 2.0631 / 4.4782 / 1.118105 / 0.00237211
hsa-miR-374b-5p / 57.8645 / 220.1964 / 1.92804 / 2.64E-228
hsa-miR-376a-3p / 0.6877 / 2.5726 / 1.903376 / 0.000704081
hsa-miR-3916 / 0.9824 / 2.382 / 1.277791 / 0.01463301
hsa-miR-410 / 1.6701 / 5.4311 / 1.70131 / 4.10E-06
hsa-miR-411-3p / 0.4912 / 1.6198 / 1.721433 / 0.013044273
hsa-miR-423-3p / 191.8664 / 94.2338 / -1.02579 / 1.69E-78
hsa-miR-424-5p / 8.6453 / 31.443 / 1.862751 / 1.29E-32
hsa-miR-4286 / 0.01 / 2.6679 / 8.059561 / 5.79E-09
hsa-miR-433 / 47.8438 / 19.4375 / -1.29949 / 1.13E-29
hsa-miR-4425 / 2.2596 / 0.7623 / -1.56764 / 0.005395573
hsa-miR-4435 / 1.9648 / 4.0018 / 1.026267 / 0.007433328
hsa-miR-4446-3p / 28.2937 / 10.3857 / -1.44588 / 3.95E-21
hsa-miR-451a / 670.8938 / 1901.0642 / 1.502651 / 0
hsa-miR-452-5p / 13.3609 / 35.5401 / 1.411431 / 3.80E-25
hsa-miR-4536-5p / 1.6701 / 0.4764 / -1.80969 / 0.008605804
hsa-miR-4707-3p / 0.393 / 6.1933 / 3.978107 / 4.23E-15
hsa-miR-4732-5p / 6.091 / 19.6281 / 1.68817 / 1.83E-18
hsa-miR-4742-5p / 0.6877 / 2.5726 / 1.903376 / 0.000704081
hsa-miR-4785 / 0.2947 / 1.2387 / 2.071508 / 0.01512505
hsa-miR-486-3p / 22.8904 / 9.2423 / -1.30842 / 3.84E-15
hsa-miR-493-3p / 2.3578 / 0.3811 / -2.6292 / 7.46E-05
hsa-miR-495 / 55.9979 / 126.9155 / 1.180424 / 3.09E-65
hsa-miR-5187-5p / 19.3537 / 8.9565 / -1.1116 / 2.15E-10
hsa-miR-5189 / 5.1086 / 10.2904 / 1.010299 / 2.00E-05
hsa-miR-532-3p / 6.3857 / 23.2488 / 1.86424 / 1.52E-24
hsa-miR-543 / 137.5386 / 46.2117 / -1.57351 / 6.37E-109
hsa-miR-548am-5p / 0.393 / 1.7151 / 2.125691 / 0.003283037
hsa-miR-548au-5p / 0.2947 / 1.7151 / 2.540974 / 0.001095108
hsa-miR-548c-5p / 0.4912 / 2.1915 / 2.157536 / 0.00073285
hsa-miR-548e / 25.3464 / 9.3376 / -1.44066 / 5.42E-19
hsa-miR-548o-5p / 0.4912 / 2.1915 / 2.157536 / 0.00073285
hsa-miR-556-3p / 1.0807 / 3.9066 / 1.853947 / 3.62E-05
hsa-miR-5706 / 0.1965 / 1.1434 / 2.540729 / 0.008761389
hsa-miR-574-5p / 4.9121 / 1.6198 / -1.60052 / 2.59E-05
hsa-miR-576-5p / 0.9824 / 6.3839 / 2.700056 / 2.35E-11
hsa-miR-582-5p / 0.2947 / 1.3339 / 2.178332 / 0.00909229
hsa-miR-589-3p / 1.2771 / 4.0018 / 1.647778 / 0.000116649
hsa-miR-589-5p / 6.5822 / 2.8585 / -1.20331 / 8.46E-05
hsa-miR-628-3p / 8.7435 / 22.9629 / 1.393022 / 1.74E-16
hsa-miR-641 / 5.0103 / 1.6198 / -1.62908 / 1.68E-05
hsa-miR-643 / 1.1789 / 0.1906 / -2.62882 / 0.006204253
hsa-miR-652-3p / 5.698 / 12.2914 / 1.109122 / 4.82E-07
hsa-miR-652-5p / 0.1965 / 1.2387 / 2.656226 / 0.0050344
hsa-miR-654-5p / 2.6525 / 0.1906 / -3.79873 / 5.80E-07
hsa-miR-659-5p / 2.1613 / 0.8575 / -1.33369 / 0.015899565
hsa-miR-664-3p / 6.8769 / 27.6317 / 2.006494 / 1.09E-31
hsa-miR-708-5p / 3.4385 / 1.6198 / -1.08596 / 0.009213784
hsa-miR-766-3p / 1.5719 / 5.4311 / 1.788735 / 1.84E-06
hsa-miR-766-5p / 71.4218 / 25.1544 / -1.50555 / 6.24E-54
hsa-miR-92a-1-5p / 96.3753 / 41.1618 / -1.22736 / 2.98E-53
hsa-miR-940 / 0.393 / 1.5245 / 1.955735 / 0.00882511
hsa-miR-941 / 20.0413 / 6.9556 / -1.52673 / 1.42E-16
hsa-miR-99b-3p / 4.6174 / 2.0962 / -1.1393 / 0.001662435

Name, the name of known miRNAs; osteopetrosis-std, read counts of each identified miRNA in osteopetrosis library normalized to the total number of small RNA reads, and multiplied by a constant set to 1×106; Health control-std, read counts of each identified miRNA in health control library normalized to the total number of small RNA reads, and multiplied by a constant set to 1×106; Fold-change(log2 ratio), Fold-change(log2 osteopetrosis/control); p value ≤ 0.05 were considered significant.

Table S2 Novel candidate microRNAs in osteopetrosis library

Name / Arm / Sequence / miRNA Length (nt) / Precursor Length (nt) / Location / MFE / Count
miRNA-01 / 3' / TCGACTTGCTCGGGCCCGGCT / 21 / 73 / chr10:104402512:104402584:- / -34.0 / 14
miRNA-02 / 5' / AGAGGATTCCGAAGACTAGGCT / 22 / 80 / chr11:5901731:5901810:+ / -26.4 / 5
miRNA-03 / 5' / GTGCGTCAGGACCGGCTTGCAA / 22 / 78 / chr11:75295100:75295177:+ / -28.9 / 14
miRNA-04 / 5' / GAGGACCCTGCAGGAATGGACGT / 23 / 76 / chr11:122650500:122650575:+ / -33.7 / 25
miRNA-05 / 3' / TCTGGAGACTGGGAGTGTTTATT / 23 / 100 / chr11:134109772:134109871:+ / -26.1 / 6
miRNA-06 / 3' / GCGATGAGGACGTGGGGTCGTGAC / 24 / 96 / chr11:2421408:2421503:- / -42.4 / 5
miRNA-07 / 5' / TGGAGGGTGAGGAGTGGCTAT / 21 / 96 / chr11:64507268:64507363:- / -48.0 / 85
miRNA-08 / 5' / AGTGGCGGCTGCAGAAAGCGTGG / 23 / 89 / chr11:109292863:109292951:- / -53.9 / 7
miRNA-09 / 5' / TCAGGGAGAAAGAAGGGTTATT / 22 / 84 / chr11:122928619:122928702:- / -21.3 / 24
miRNA-10 / 3' / GAGAGCTCCGACTGCAGCTGC / 21 / 95 / chr11:133027217:133027311:- / -35.3 / 50
miRNA-11 / 3' / CTTGCAGGGCAGAGAGCAGAA / 21 / 69 / chr12:56391684:56391752:+ / -24.4 / 5
miRNA-12 / 3' / TTGTGGAAACAATGGTACGGCA / 22 / 92 / chr15:45493361:45493452:+ / -28.7 / 42
miRNA-13 / 5' / TTCTGGAGGGATGGGTAGGAGCC / 23 / 89 / chr16:1814046:1814134:+ / -42.9 / 12
miRNA-14 / 3' / GGCTCGTGGCCTGCAGTGGATG / 22 / 75 / chr16:30198251:30198325:+ / -31.5 / 6
miRNA-15 / 5' / TGACACTGTGGGGAACGTGCA / 21 / 83 / chr16:30198328:30198410:+ / -29.2 / 17
miRNA-16 / 5' / ACTGGCAAAAGGGTTTAGAACT / 22 / 81 / chr16:50830166:50830246:+ / -20.3 / 33
miRNA-17 / 3' / TCACGTCTGCGGCTGTCACGT / 21 / 93 / chr16:87887450:87887542:+ / -30.9 / 7
miRNA-18 / 5' / AGCAGGCAGGGATTGGGAGCAC / 22 / 68 / chr16:57843868:57843935:- / -39.3 / 7
miRNA-19 / 5' / TGTTGGGGATTCGGGTGGCCAGA / 23 / 75 / chr16:88943676:88943750:- / -28.8 / 10
miRNA-20 / 5' / GTGAGTGCGGGCTGGGCACAAGT / 23 / 73 / chr17:6347799:6347871:+ / -32.0 / 10
miRNA-21 / 5' / GGCAGAGAGGAGGAGAGAATTG / 22 / 75 / chr17:27192986:27193060:+ / -26.2 / 5
miRNA-22 / 5' / TCAGGGGATGGGAGTGACATG / 21 / 81 / chr17:72519035:72519115:- / -38.6 / 6
miRNA-23 / 5' / TTGGAGGGTGTGGAAGACATC / 21 / 85 / chr19:13051290:13051374:+ / -31.0 / 8
miRNA-24 / 5' / TGGGGGACGAGAGAGTGACAGTA / 23 / 87 / chr19:15575180:15575266:+ / -44.4 / 6
miRNA-25 / 5' / AGGGGACGGGATGGAGGAACAGA / 23 / 77 / chr19:35761280:35761356:+ / -35.6 / 6
miRNA-26 / 5' / TCCTGGAGCTGGGCAGATGGGA / 22 / 75 / chr19:2762628:2762702:- / -35.7 / 37