Supplementary data
Genomic DNA extraction and PCR
The total genomic DNA was usually extracted usingthe method of Newman et al. (1990).A rapid procedure (picking up colonies with a pipette tip, resuspending the cells in 10 µl distilled water, and then heating for 30 min at 95º C) was used when possible. Finally, a commercial procedure (DNAeasy Plant Mini Kit, Qiagen) was followed when high-purity DNA was required.
PCR amplification of the GUS gene was carried outin a 15 µl reaction volume containing 2.5 µl genomic DNA, 1.5 mM MgCl2, 0.2 mM dNTP, 0.25 µM specific primers (either sGUSor lGUS primers - Supplementary Table 1), and 1 unit Platinum Taq polymerase (Promega). Reaction conditions comprised initial denaturation at 94º C for 5 min, followed by 38 cycles of 94º C for 30 s, 56º Cfor 30 s, and 72º C for 40 s, ending with a final extension at 72º C for 10 min. The reaction mix in PCR for Shble was as before exceptfor5 µl genomic DNA andShble specific primers (Supplementary Table 1). Reaction conditions were as follows: initial denaturation at 95º C for 2 min, and then 35 cycles at 95º C for 30 s, 68º C for 30 s, and 72º C for 45 s, ending in a final extension at 72º C for 5 min. .
Determination of GUS activity
GUS activity in S. almeriensisclones was determined by the histochemical staining of cells and a fluorometric assay on protein extracts. To this aim, inoculation was performed from clones grown on DWNA+Hyg15 plates in 2 mlTAP liquid medium. After growth to 0.5OD600 (approx. 5 x 106 cells/ml), cells were stained using the X-gluc chromogenic substrate as described in Úbeda-Mínguez et al. (2014). GUS activity was also checked in selected S. almeriensistransformants by quantitative determination of GUS enzymatic activity in cell extracts. Briefly, microalgalcells were liquid-cultured in TAP to 0.3-0.4 OD600 and then 15 ml (equivalent to 30-50 mg wet biomass) was processed. The pelleted biomass was washed twice with 0.1 M phosphate buffer,at pH 7, transferred to an Eppendorf tube and kept on ice. Extract preparation and fluorometric GUS assays wereperformed in accordance with a standard protocol as described elsewhere (Chileh et al. 2010).
Stability oftransformed clones
We followed the same procedure used with Tetraselmischuii(Úbeda-Mínguez et al. 2014). Briefly, several randomly-selected ZeoR clones were kept formore than one year in antibiotic-free media and then plated on Zeo-free DWNA. One hundred colonies were randomly picked from these plates and spotted in DWNA+Zeo15 and inZeo-freeDWNA. All the growing spots were ZeoR (100%). When re-checked for GUS activity,they showed similar values to the initial ones.
Supplementary Table 1. Primers used for the PCR, the sequence and the expected size of the corresponding amplicon.
Primer / Sequence (5’-3’) / Amplicon (bp)sGUS-For / TACGGGAAAGGACTGGAAGAGAAGTG / 580
sGUS-Rev / TCCTCATCCACGACCGACACTTTCAC
lGUS-For / ACACCGAGACCCGTGGCGTCTTCGACC / 700
lGUS-Rev / CCACGTTACCGCTCAGGCCCTCGGTGC
Shble-For / CTCGAGTCAGTCCTGCTCCTCTGCC / 730
Shble-Rev / ACCTCCTCGGATTCCATTGCCCAGC
1