Figure S1. Excerpt of pharmacological chaperone- (DGJ-) treated GLA mutations.
Figure S1: -Gal A enzyme activity raised in HEK-293H cells expressing GLA mutations treated with the pharmacological chaperone DGJ. -Gal A mutations were overexpressed in HEK-293H and tested for enzyme activity with (black bars) or without (white bars) the pharmacological chaperone 1-deoxygalactonojirimycine (DGJ). An excerpt of 32 mutations is shown (21 responders, left part, 11 non-responders, right part). A mutation was defined as a responder when its activity was elevated 1.5-fold or at least 5 % above the untreated state.9 Among the responders, some mutations were selected as putative model mutations for small molecule screening in Fabry disease in this study. Results are shown as mean ± SEM (n ≥ 3).
Figure S2. ABX concentration-dependent increase of PC-treated p.A156V -Gal A activity.
Figure S2: ABX concentration-dependent activity enhancement of DGJ-treated -Gal A mutant p.A156V. The pharmacological chaperone DGJ was applied at a constant concentration of 20 µM in combination with different ABX concentrations (range: 100 nM to 120µM). An EC50 of 13.0 µM was determined which did not significantly differ from the EC50 obtained for the effectiveness of ABX on the wild type enzyme (p=0.4529) (Fig. 2b). Results are shown as mean ± SEM. At least 3 independent experiments were carried out for each data point.
Figure S3. Synergistic effect of a galactose/ABX combination on galactose-responsive GLA mutations.
Figure S3: -Gal A enzyme activity raised in HEK-293H cells expressing GLA mutations treated with the pharmacological chaperone galactose and a combination of galactose and ABX. Galactose-staggered medium (100 mM) was able to stimulate mutant -Gal A activity in the applied system. All tested mutations were likewise responsive as to DGJ. In combination with ABX, both compounds affected mutant -Gal A activity synergistically. Experiments were conducted as duplicates in two independent experiments and results are shown as mean ± SD.
Figure S4. ER protein homeostasis re-modeling agents did not have a significant effect on p.R301Q -Gal A activity.
Figure S4: -Gal A mutant p.R301Q treated with MG-132, Tunicamycin, Thapsigargin and Kifunensin. Mutant p.R301Q enzyme was overexpressed in HEK-293H cells and treated for 60 hrs post-transfection with MG-132, Kifunensine, Thapsigargin and Tunicamycin in the presence or absence of the pharmacological chaperone DGJ. None of the four compounds did exert a significant benefit to the mutant form of -Gal A.
Figure S5. Agalsidase alfa inhibition assay with DGJ and ABX.
Figure S5: Inhibition assay of recombinant -Gal A (agalsidase alfa, Shire Human Genetic Therapies Inc., Berlin, GER). The assay was carried out at pH 4.7 reflecting the acidic conditions prevalent in the lysosome. Recombinant enzyme was mixed with increasing concentration of compound. Upon the addition of substrate, the reaction was started. After 15 minutes, the reaction was stopped using a low pH buffer. The fluorescent reaction product was measured in a plate reader thereafter. DGJ inhibited the enzyme in nanomolar concentrations as reported before.21 In order to show the specificity of the assay, an inhibitor for lysosomal galactosylceramidase, -Lobelin, was negatively tested on -Gal A as well (open circles). ABX (open squares) showed modest, but significant inhibition only when applied at a concentration of 2.5 mM. A potential change of the inhibitory function of DGJ under a constant addition of 2.5 mM ABX (red curve) was not observed. Data was obtained from at least 5 independent experiments, each experiment included duplicate measurements. Values are shown as mean ± SEM (n ≥ 5). Results were considered significant if *p<0.05, **p<0.01, ***p<0.005
Figure S6. Proteasomal inhibitors MG-132 and Lactacystin increased cellular -Gal A mutants.
Figure S6: Western blot analysis of MG-132 and Lactacystin-treated -Gal A mutants p.A156V and p.R301Q. Mutant -Gal A forms were overexpressed in HEK-293H cells and treated for 60 hrs post-transfection with 100 nM MG-132 and 1 µM Lactacystin. After cell harvest, the protein lysates were subjected to Western blot analysis. The amount of p.R301Q -Gal A was increased (right) while that of p.A156V remained unchanged (left) in proteasome inhibitor treated cells.
Table S1. Proteasomal activities in compound-treated HEK-293H cells.
proteasomal activity* / MG-132 / Lactacystin / Bortezomib / Ritonavir / RSGconcentration / 0.1µM / 1µM / 1µM / 10nM / 25nM / 10µM / 100µM / 100µM
Chymotrypsin-like [%] / 89.2 / 11.0 / 31.7 / 62.8 / 2.4 / 116.9 / 80.1 / 102.4
Trypsin-like [%] / 157.9 / 83.6 / 84.4 / 156.5 / 62.3 / 113.6 / 91.7 / 102.0
Caspase-like [%] / 120.0 / 51.1 / 90.3 / 73.8 / 1.3 / 120.4 / 50.7 / 106.3
Table S1: Proteasomal activities were measured with the different Proteasome-Glo™ cell-based assays reagents (Promega, Mannheim, Germany, see Supplementary Method “Proteasomal activity measurement in HEK-293H cells” below) were measured 12 hrs after treatment start.
* Normalized against control (DMSO-treated) cells
Table S2. Primer registry.
Cloning primersGene / Primer / Sequence / Restriction enzymes / Expression vector name
GAA / GAA_frw
GAA_rev / taggagctgtccaggccatc
gagagactaacacactccgc / HindIII
XhoI / pcDNA3.1/V5-His TOPO
GLA / GLA_frw
GLA_rev / aggtcggatccgacaatgcagctgaggaacc
ggtgttcgaattaaagtaagtcttttaatgacatctgca / BamHI
BstBI / pcDNA3.1/V5-His TOPO
Mutagenesis primers
GAA / R375L_frw
R375L_rev / cttccacctgtgcctctggggctactcct
aggagtagccccagaggcacaggtggaag
GAA / Y455F_frw
Y455F_rev / ctgccgggagcttcaggccctacga
tcgtagggcctgaagctcccggcag
GAA / P545L_frw
P545L_rev / caccctacgtgcttggggtggttgg
ccaaccaccccaagcacgtagggtg
GAA / L552P_frw
L552P_rev / ttggggggaccccccaggcggccac
gtggccgcctggggggtccccccaa
GAA / Y575S_frw Y575S_rev / ctgcacaacctctccggcctgaccgaa
ttcggtcaggccggagaggttgtgcag
GLA / R118C_frw
R118C_rev / ctttcctcatgggatttgccagctagctaatta
taattagctagctggcaaatcccatgaggaaag
GLA / A156V_frw
A156V_rev / ctacgacattgatgtccagacctttgctg
cagcaaaggtctggacatcaatgtcgtag
GLA / R301Q_frw
R301Q_rev / ctaatgacctccaacacatcagccc
gggctgatgtgttggaggtcattag
GLA / T385A_frw
T385A_rev / tgcctgcttcatcgcacagctcctccc
gggaggagctgtgcgatgaagcaggc
Supplementary Method 1
-Gal A enzyme inhibition test
In vitro inhibition assay was carried out using 10 – 50 ng of human recombinant -Gal A (agalsidase alfa, Replagal) in a volume of 10 µl 0.06 M phosphate-citrate buffer (pH 4.7 and 6.7) including increasing concentrations of the compound to be tested. The reaction was started by the addition of 20 µl of the substrate 4-Methylumbelliferyl-α-D-galactopyranoside solution (stock concentration: 1.84 M). Samples were kept under slight agitation in a 37°C water bath for 15 minutes. To stop the reaction, 200 µl of glycine-NaOH buffer (pH 10.5) was added, the samples were transferred to a 96-well plate (Greiner bio-one GmbH, Frickenhausen, GER) and immediately surveyed as described above.
Supplementary Method 2
Proteasomal activity measurement in HEK-293H cells
HEK-293H cells were seeded in a 12-well plate format and cultivated for 24 hrs before the compounds were added to the medium. Afterwards, cells were treated for 12 hrs with the compound. A reference well treated with the respective compound served as a control for cell number determination. Here, cells were trypsinized and counted in a CASY model TT cell counter (Roche Innovatis AG, Bielefeld, Germany). Cells subjected to the proteasomal activity measurement assay were harvested in an according volume of 10°C cold PBS and 2 x 104 cells dissolved in 100 µl were transferred to a 5-mL round bottom polystyrene tube used for the recording. The three different substrates for the distinct proteasomal activities were prepared according to the manufacturer’s instructions and 100 µl of the resulting Proteasome-Glo™ Cell Based reagent were added to the cell suspension, incubated for 10 minutes and measured in a luminometer (Lumat 9507, berthold technologies, Bad Wildbad, Germany) immediately thereafter.