Ex Vivo Analysis of Splicing Assays

Comments have the following color code

Comments by Stefan

Glossary

Refereal to other chapters, please do not change

List of vendors

Reagents added to the database

Enter clones into the common database

login superadmin

pw golgi

look at the book chapters at the eurasnet site:

stefanstamm galadriel

Title:Ex vivo analysis of splicing assays

Can this be changed to in vivo splicing assays, as this is how it is referred to throughout the book

Authors: Isabel Cristina López Mejía and Jamal Tazi

Affiliation: Institut de Génétique Moléculaire de Montpellier UMR 5535 CNRS, 1919 route de Mende, 34293 Montpellier cedex 5, France; Université Montpellier 2, Place Eugène Bataillon, 34095 Montpellier cedex 5; Université Montpellier 1, 5 Bd Henry IV, 34967 Montpellier cedex 2.

e-mail address

ABSTRACT

It is more and more evident that a number of human diseases are due to changes in alternative splicing patterns (Ward et al., 2009; López-Bigas et al., 2005). The question is how to improve our understanding of new disease-causing mutations, that do not affect the coding potential of a gene, but that affect pre-mRNA splicing.

The use of reporter minigenes in transfection assays, commonly referred to as in vivo splicing assays is the most frequently used method to analyse alternative splicing patterns.

In order to analyse precise mechanism of alternative splicing most laboratories use so-called mini-gene reporters.The splicing reporters can easily be transfected in a large number of cell lines. The use of a splice site can then be assayed by RT-PCR or qRT-PCR.

Ex vivo analysis of In vivo splicing assays can be an accurate, rapid and simple method to reproduce splicing events seen in an intact organism.in vivo. For example it can serve to study the effects of the knock-down or the over-expression of any factor on the studied splicing event. For larger screens, adapted reporters may be constructed. Splicing reactions may then be studied without RNA isolations followed by RT-PCR reactions. After the construction of stable cell lines, a splicing event can then be analysed on a larger scale, simply by using luciferase or fluorescence assays for example. In the laboratory, we have developed the two kinds of analysis to study the regulation of one single splicing event that is responsible for the majority of the cases of one rare disease: Hutchinson-Gilford Progeria Syndrome.

Keywords: splicing reporter, transfection, alternative splicing, HGPS.

THEORETICAL BACKGROUNG

1. Studying an alternative splicing event.

Traditionally, single alternative splicing events were analysed by in vitro splicing assays. This cell-free strategy allows you one to study splicing, and splicing only, of an RNA of your choice (see chapter by Mayeda).

Nevertheless, splicing substrates based on human genes, which contain large introns and suboptimal splice sites, do not always splice efficiently in vitro.

Moreover, when you one wishes to study the consequence of the lack or the excess of one factor on one single splicing event in vitro, the in vitro splicing strategy may be laborious and time consuming.

Current laboratory cell lines, like HeLa and HEK 293, constitute living “splicing factories” that can be used to assess the behaviour of splicing reporters after transient transfection. These reporters carry the splicing sites to study, plus the “theoretical” cis-elements that are required for their regulation (see chapter xxx Stamm for construction of minigenes).

In vivo analysis of splicing allows us to precisely study the regulation of a certain number of alternative splicing events. Indeed, one can study directly the cis-elements by site directed mutagenesis, and/or study the influence of different trans-factors (SR proteins, hnRNPs) by cotransfection of plasmids encoding for these factors (Cáceres et al., 1994) or by siRNA or shRNA treatment.

Our studies focus on splicing events that concern 5’ splice sites in exon 11 of LMNA (lamin receptor A) gene. Indeed, the inclusion of the 3’ fraction of exon 11 of the LMNA gene is required for the proper posttranslational maturation of pre-lamin A. Incomplete maturation leads to a dominant negative form that is highly cytotoxic and that is at the origin of the progeria phenotype [Figure 1]. Splicing reporters reproducing the splicing regulation that is responsible for the progeria phenotype will be presented in this chapter in order to provide the reader an example of ex vivo splicing analysis.

1. Transfectionof adherent cell lines:

There are three main kinds type of methods to transiently or stably transfect adherent cells.

1. Calcium phosphate based transfection has been used for nearly 40 years to transfect plasmid DNA into cultured cells. The DNA is introduced into the cells through an unknown mechanism that implies the attachment of a precipitate to the cell membrane. It was first used in 1973 (Graham et al., 1973),and is still being used, mainly because of its low cost. It only involves plasmid DNA and simple solutions that can easily be prepared in any laboratory.

Nevertheless, in order to achieve high transfection efficiencies, various steps of optimization may be required. Indeed, it has been shown that transfection efficiency is highly dependent on several parameters, for example, a very narrow pH range, CO2 concentration, the size of the complexes and the quality of plasmid DNA.

1. Electroporation involves the creation of pores in the cell’s plasma membrane by an electric field (Wong et al., 1982; Potter, 1988). This method is commonly used for suspension cell lines, like Jurkat cells (immortalized T lymphocytes that are difficult to transfect with other procedures). This method can give rise to high transfection efficiencies after optimization (Chu et al., 1987), but it requires special equipment and very often leads to a very high level of cell death. To our knowledge, experimentalists have had a hard time achieving a compromise between effective transfection and high survival rate of the cells.

1. Finally, many laboratories currently use cationic lipid-mediated transfection.

The DreamFectTM (vendor?, can you please give the name and address at the end of the chapter) reagent is the commercial cationic lipid-mediated transfection reagent that we use in the laboratory. It is based on the Tee-Technology (Triggered Endosomal Escape). DreamFectTM contains a polyamine that ensures the interaction of the reagent with plasmid DNA and a lipophile that ensures the interaction of the plasmid DNA containing complex with the cell surface. The hydrophobic properties of the complexes also facilitate the transit of the DNA from the endosomal compartment to the nucleus.

The main advantages that we found with this reagent when compared to other reagents is the price, the reproducibility, the broad specificity, and specially the fact that any investigator can achieve successful transfections, especially when compared to calcium phosphate transfection.

This reagent has also been successfully used to perform siRNA treatment, but we have obtained better results when transfecting siRNAS with Oligofectamine Reagent (Invitrogen): this reagent is also a cationic lipid.

2. Protocol, exAmple of an experiment

1. Scientific background: can you move this up into the background part

Hutchinson-Gilford progeria syndrome (HGPS) is a rare genetic disorder phenotypically characterized by

numerous features of premature aging. Most of HGPS patients carry a heterozygous silent mutation that

activates the use of a cryptic 5’ splice site in exon 11 ofLMNA pre-mRNA. This aberrant splicing event leads to the production of a truncated protein called progerin, this protein has a dominant negative effect which is responsible for the observed phenotype (De Sandre-Giovannoli et al., 2003; Eriksson et al., 2003).

Both in vitro and ex vivo experiments showed that the single point mutation (1824C>T) in exon 11 was sufficient to induce utilization of a cryptic 5’ splice site in exon 11. The truncated splicing isoform lacks 150 nucleotides when compared to the full length splicing isoform.

1. Reagents and solutions needed:

• Dreamfect ReagentTM (OZ biosciences)
• DMEM medium (GIBCO) supplemented with 10% Fetal Bovine Serum and antibiotics
• Opti-MEM medium (GIBCO)
• D-PBS (GIBCO)
• TRI Reagent (SIGMA), caution, this product contains phenol. Handle with extreme caution to avoid contact and ingestion.
• Chloroform
• Isopropanol
• Ethanol
• RNase-free water or DEPC (diethylpyrocarbonate) -treated water.
• First Strand cDNA synthesis kit (Amersham), contains dNTPs and random hexamers.
• Forward primer for PCR, sequence: 5’GCTTCTGACACAACTGTGTTCACTAGC3’
• Reverse primer for PCR, sequence: 5’GCAGTTCTGGGGGCTCTGG3’
• PCR reagents.

1. Materials

• HeLa cells are our standard, but a broad range of cell lines has been used successfully for this experiment, including HEK293, MCF-7, MDA 231, and HCT-116 cells
• Splicing reporter: Wild type and Mutant Progeria expression clones. The aim of presenting these plasmids is only to provide researchers with an example of this kind of experiment, see figure 3 for a schematic figure of our mini-gene reporters and of the anticipated result. Are these really expression clones for protein or do they just make RNA, could you please add the clones to the database?
• 6-well tissue culture plates
• Humidified incubator at 37°C, 5%CO2.
• RNase-free microcentifuge tubes.
• Refrigerated microcentrifuge.
• Thermocycler.

1. Transfection protocol [Figure2]:

1-The day before transfection, seed ~ 5.105 cells per well in a 6-well plate with 1.5 ml of complete DMEM growth medium (supplemented with 10% FBS + ATB, add antibiotics).

2-Incubate the cells at 37°C in a CO2 incubator. The day of the transfection the cells should be subconfluent.

3-For each well to be transfected, dilute 1µg of DNA into 100µl Opti-MEM I Reduced Serum Medium.

4-For each transfection, dilute 4µl of DreamFectTM into 100µl Opti-MEM medium and gently mix (do not vortex!)

Combine diluted DNA (from step 3) and DreamFectTM (from step 4), mix gently and incubate at room temperature for 20 min to allow transfection complexes to form. While complexes are forming, replace the medium on the cells with 0.8 ml Opti-MEM medium. Never vortex or centrifuge the solutions.

Never use serum-containing media for steps 3 and 4 as serum will impede the proper formation of complexes. .

5-Overlay the complex solution onto the cellswith freshly replaced medium.

6-Incubate the cells with the complexes for 6 hours at 37°C in a CO2 incubator.

7-Following incubation, remove the transfection mixture, wash the cells with D-PBS, and replace with complete DMEM growth medium.

8-Recover the cells for RNA or protein extraction 24 hours after addition of serum containing medium to the transfected cells.

For protein overexpression, a minimum time of 16 to 18h of expression is usually required. Plasmids encoding for splicing factors can then be cotransfected with the splicing reporters. Concerning siRNA knockdown, longer incubations are usually required in order to see an effective downregulation on Western Blots. We recommend 72 to 96 h experiments. Splicing reporters should then be transfected from 16 to 24h before the time of recovery of the cells. For newly constructed reporters, the time course should be optimized in pilot experiments.

1. RNA extraction protocol:

1-Lyse cells directly on the culture dish. Use 500 µl of TRI Reagent per well. Incubate for 5 min at room temperature. After addition of the reagent, cell lysates should be passed several times through a pipette’s tip to form an homogenous lysate before recovering in 1.5 ml microcentrifue tubes (we recommend the use of cell lifters (vendor?, is this the proper name?) before recovering the cell lysate). The reagent should become viscous (viscosity is an indicator of cell lysis).

To ensure complete dissociation of nucleoprotein complexes, allow samples to stand for 5 more minutes at room temperature. Add 100 µl of chloroform. Cover the sample tightly, vortex vigorously for 15 seconds and allow them to stand for 10 minutes at room temperature. Centrifuge the resulting mixture at 13,000 x g for 15 minutes at 4°C. Centrifugation separates the mixture into 3 phases: a pink organic phase (containing protein), an interphase (containing DNA), and a colourless upper aqueous phase (containing RNA)

2-Transfer the aqueous phase to a fresh tube and add 250 µl of isopropanol and mix (the pink lower phase may be stored for subsequent protein isolation. This is particularly interesting if you are performing siRNA or overexpression experiments). Allow the sample to stand for 10 minutes at room temperature. Centrifuge at 13,000 g for 15 minutes at 4°C. The RNA precipitate will form a pellet on the side and bottom of the tube. If you think your sample contains little RNA, the addition of 1µl of glycogen (20mg/ml) will help precipitation and the visualization of the pellet. Are you using glycogen or glyco blue from ambion?

Remove the supernatant and wash the RNA pellet by adding 500 µl of 80% ethanol. Vortex the sample and then centrifuge at 7,500 x g for 5 minutes at 4°C.

3- Remove the supernatant and briefly dry the RNA pellet for 5-10 minutes by air-drying. Do not dry the RNA pellet by centrifugation under vacuum (speed-vac). Do not let the RNA pellet dry completely, as this will decrease its solubility and might degrade it. Add an appropriate volume of DEPC treated water (10-30 µl according to the size of the pellet).

4-Determine the RNA concentration of an aliquot diluted in water by measuring the optical density at 260 nm. A260.

5-Verify the integrity of the extracted RNAs by agarose gel electrophoresis.

1. RT-PCR protocol:

cDNA synthesis using an Amersham Biosciences kit: kit number?

1-Place 1.5 µg total RNA in a microcentrifuge tube and add RNAse-free water, if necessary, to bring the RNA to a total volume of 4 µl.

2-Denature the RNA by heating the RNA solution at 65°C for 10 minutes, then chill on ice.

3-Gently pipette the Bulk first-strand cDNA reaction mix to obtain a uniform suspension. Then add a mixture containing 2.5 µl of the Bulk first-strand cDNA reaction mix to the RNA, 0.5 µl DTT solution (200mM) and 0.5 µl pd(N)6 random hexamers (0.2 µg/µl).

4-Incubate at 37°C for 1 hour.

PCR reaction:

1-The RT reaction is diluted 1 to 5. Place 2 µl of the diluted cDNA in a microcentrifuge tube and add a mix containing:

• 5 µl 10X PCR Buffer (20mM Tris-HCl pH 8.4, 500 mM KCl )
• 1 µl Magnesium Chloride 50 mM
• 0.5 µl dNTP mix 10mM
• 0.5 µl Primer mix (20 µM each)
• 0.25 µl Taq DNA polymerase (5U/µl)
• 40.75 µl autoclaved distilled water

2-Cap tubes and centrifuge briefly to mix and collect the contents at the bottom

3-Incubate tubes in a thermal cycler at 94°C for 3 minutes to completely denature the template

4-Perform 28 cycles of PCR amplification as follows:

• Denature 94°C for 30 sec
• Anneal 64.2°C for 30 sec
• Extend 72°C for 30 sec

5-Incubate for an additional 2 minutes at 72°C and maintain the reaction at 15°C.

6-Analyse the amplification products by 2% agarose gel electrophoresis and visualize by ethidium bromide staining. Use 1 Kb+ molecular weight standard. Load with xylene cyanol only, as bromophenol blue might interfere with the visualization of the truncated amplicon. The same primers amplify both splicing isoforms.

7-Can you also give the primer sequences for rt-pcr

3. Example of an experiment

The outcome of a typical experiment are shown in Figure 1. Isabel: can you also show an ethidoium bromide stained gel?

TROUBLESHOOTING TABLE / TROUBLESHOOTING TABLE / TROUBLESHOOTING TABLE
PROBLEM / POSSIBLE CAUSE / SOLUTION
Low transfection efficiency. / Insufficient cell proliferation rate.
Amount of DNA used is insufficient.
Suboptimal DreamfectTM/DNA ratio.
Bad quality of the transfected DNA. / Optimize the confluency according to the cells used.
It is also possible to transfect freshly seeded cells.
High passage number.- use a lower passage number
Mycoplasma contamination.
The amount of DNA used can be increased.
DreamfectTM should be used in excess, for oprtimization, maintain a fixed DNA quantity and then vary the amount of DeamfectTM.
Prepare DNA with cesium chloride gradients or commercial columns (quiagen?).
RNA not detected on gel. / Degradation of RNA during TRIREAGENT isolation. / Verify that the solutions, tubes and tips you use are RNase free.
Wear clean gloves at all times.
Reduce incubation time with TRIREAGENT
Be careful, in-gel degradation is also possible!, exchange gel reagents
PCR product not detected on gel. / Low transfection efficiency.
cDNA synthesis is not successful.
Insufficient RNA in reverse transcription reaction. / See top of the table
RNA secondary structure may prevent RT, reverse transcriptionverify you correctly denature your RNA by incubating at 65°C for 10 min and then cooling on ice for at least 3 minutes.
Verify that your sample is not contaminated with DNA (gel analysis) or proteins (determine the ratio of optical density at 260 to 280 nm A260/A280), because this might let you overestimate the amount of RNA you use for reverse transcription.
PCR product generated in the RT minus control. / DNA contamination in the RNA sample. / Perform a DNase treatment of your RNA (we use RQ1 DNase).
Prefer Use exon junction primers for your PCR reaction.
The volume of TRIREAGENT used might have been insufficient for a proper sample homogenization.

Figure 1: The use of a cryptic 5’ splice site is at the origin of the Hutchison Gilford Progeria Syndrome

A) In normal individuals, a distal 5’ splice site is used in exon 11 of LMNA gene. The encoded mRNA will be translated into prelamin A. This protein will undergo 4 steps of postranslational maturation. Mature lamin A is a component of the nuclear envelope .

B) In HGPS patients, there is an activation of a cryptic splice site in exon 11 of LMNA gene. The use of this cryptic splice site leads to the deletion of 150 nucleotides, thus 50 aminoacids, from prelamin A. This truncated prelamin A will undergo an incomplete maturation and remain farnesylated, thus aggregating in the nuclear periphery. The nuclear abnormalities that are caused by the truncated protein, called progerin, are responsible for progeria.

References

Ward, A.J., and Cooper, T. A. (2010). The pathobiology of splicing. J. Pathol. 220, 152-163.

López-Bigas, N., Audit, B., Ouzounis, C., Parra, G., and Guigo, R. (2005) Are splicing mutations the most frequent cause of hereditary disease? FEBS Lett. 579, 1900-1903.

Cáceres, J.F., Stamm, S., Helfman, D.M., and Krainer, A.R.(1994). Regulation of alternative splicing in vivo by overexpression of antagonistic splicing factors. Science. 265, 1706–1709

Graham, F.L., and van der Eb, A.J. (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology.52, 456

Wong, T.K., and Neumann, E. (1982). Electric field mediated gene transfer. Biochem. Biophys. Res. Commun. 107, 584-587