Dilutions and Concentrations

Molecular Biology 2016

Assignment 1

Dilutions and Concentrations

Only submit the answers to one digit after the decimal, you do not need to show your calculations

(1 point/question)

1.You add water to 125 mL of 1.6 M LiCl to obtain 1.0 L of solution, what is the new concentration of LiCl?

2.In the previous problem, the solution contains how many parts of solute and of solvent?

3.You start with 2.5L of a KNO3stock solution and wish to prepare 10.0 L of 1.5 M KNO3. What molarity would the potassium nitrate stock solution need to be if you were to use it all?

4.How many milliliters of 5.0 M copper sulfate solution must be added to 228 mL of water to achieve a 0.25 M copper sulfate solution?

5.40.0 mL of 2.0 M Fe(NO3)3 is mixed with 2 mL of 5 M Fe(NO3) and 48 mL of water.What is the final molar concentration of Fe(NO3)?

6.You add 3.5 L of an HCl solution of unknown concentration to 2.0 L of 0.5 M HCl and obtain a solution with a final concentration of 1.5 M. What was the unknown concentration of the initial HCl solution?

7.You have a solution representing 126g/L of NaF (MW: 42g/mole). 180 mL of this solution is added to water to obtain a final volume of1080 mL.What is the molarity of the resulting solution?

8.What is the molar concentration of chloride ions in a solution prepared by mixing 100.0 mL of 2.0 M KCl with 50.0 mL of a 1.50 M CaCl2 solution?

9.A solution is prepared by dissolving 54 g of AgNO3 in 156 mL of water. What is the percent concentration (m/m) of AgNO3of this solution?

10.The A260nm of a DNA solution is 0.12. How much of this DNA solution and a 5.5X loading dye should you add to 15µL of water to obtain a sample which contains 30ng of DNA in 0.5X loading dye? (A260nm of 1.0 = 50 µg/mL DNA)

1.0.2M / 6.2.1M
2.1 part solute & 7 parts of solvant / 7.0.5M
3.6M / 8.2.3M
4.12 mL / 9.25.7
5.1M / 10.5µL DNA and 2µL dye

Restriction Enzymes & Restriction Mapping

(3 points/question)

11.The nomenclature of restriction enzymes can provide useful information about the source of the enzyme. For example, EcoRI indicates that this enzyme was the first enzyme isolated from an E.coli strain “R”. From which bacteria was PvuII isolated from?

Proteus vulgaris

12.Define the following terms: Isoschizomer, neoschizomer, and isocaudomer.

Isoschizomers: restriction enzymes specific to the same recognition sequence and cut in the same location.

Neoschizomer: An enzyme that recognizes the same sequence but cuts it at a different position.

Isocaudomer: An enzyme that recognizes a different sequence, but produces the same ends.

13.Amongst the enzymes listed below, which if any, generate compatible ends to each other? (Ex. A and B)

Enzyme / Recognition Sequence / Cut
EcoRI / 5'GAATTC / 5'---G AATTC---3'
BamHI / 5'GGATCC / 5'---G GATCC---3'
HindIII / 5'AAGCTT / 5'---A AGCTT---3'
TaqI / 5'TCGA / 5'---T CGA---3'
NotI / 5'GCGGCCGC / 5'---GC GGCCGC---3'
Sau3AI / 5'GATC / 5'--- GATC---3'
PvuII / 5'CAGCTG / 5'---CAG CTG---3'
KpnI / 5'GGTACC / 5'---GGTAC C---3'
PstI / 5'CTGCAG / 5'---CTGCA G---3'
SacI / 5'GAGCTC / 5'---GAGCT C---3'
SalI / 5'GTCGAC / 5'---G TCGAC---3'
ScaI / 5'AGTACT / 5'---AGT ACT---3'
SpeI / 5'ACTAGT / 5'---A CTAGT---3'
SphI / 5'GCATGC / 5'---GCATG C---3'
StuI / 5'AGGCCT / 5'---AGG CCT---3'
XbaI / 5'TCTAGA / 5'---T CTAGA---3'

BamHI – Sau3AI

PvuII-ScaI-StuI

SpeI-XbaI

14.The linear 12 Kbp DNA fragment shown below has cleavage sites for BamHI and EcoRI. The numbers indicate the distance in kilobases. Complete the table to indicate the fragment sizes which would be observed on an agarose gel following each of the indicated digests. Note, if different fragments of the same size are generated, the size should only be indicated once. (For example do not indicate 2Kbp and 2Kbp)

Enzyme digest / Fragment sizes
BamHI / 1, 5, and 6Kbp
EcoRI / 2, 4, and 6Kbp
BamHI + EcoRI / 1, 2, 3, and 4Kbp

15.What fragment sizes could be generated from a BamHI partial digest? Only indicate the sizes of intermediate fragments which would not be obtained following a complete digest.(Fragments which contain one or more BamHI site which remains undigested)

12, 6 and 11 Kbp

16.Consider the results of the BamHI digest you indicated in the above table. Draw all possible maps, (including the one illusrated above) which could correspond to the results indicated for the BamHI digest alone.

(1,5,6), (6,1,5), (5,6,1), (6,5,1), (5,1,6), (1,6,5)

17.It was determined that the enzyme XhoI cuts at 2.0Kbp on the map shown above. Indicate which BamHI fragment would be cut by XhoI and what sizes would be generated in each of the maps provided for question 16. (Ex. 4Kbp BamHI → 3 + 1 Kbp).

5→1+4, 6→2+4, 5→2+3, 6→1+5

18.A complete digest with EcoRI + BamHI of 12µg of the above fragment was performed. Indicate the amount in µg of each of the fragments which would be obtained.

1 µg of 1Kbp

4 µg of 2Kbp

3 µg of 3Kbp

4 µg of 4Kbp

19.The circular 10KbpDNA molecule shown below has cleavage sites for BamHI and EcoRI. Complete the table to indicate the fragment sizes which would be observed on an agarose gel following each of the indicated digests. Note, if different fragments of the same size are generated, the size should only be indicated once. (For example do not indicate 2Kbp and 2Kbp)

Enzyme digest / Fragment sizes
BamHI / 3 and 7Kbp
EcoRI / 10Kbp
BamHI + EcoRI / 3 and 4Kbp

20.What fragment sizes could be generated from a BamHI partial digest? Only indicate the sizes of intermediate fragments which would not be obtained following a complete digest.(Fragments which contain one or more BamHI site which remains undigested)

10Kbp

21.Consider that the EcoRI site is invariable. Is this the only possible map according to the results presented in the above table? If not draw another possible map.

22.It was determined that the enzyme XhoI cuts at 9Kbp on the map shown above. Indicate which BamHI fragment would be cut by XhoI and what sizes would be generated in each of the maps from questions 19 and 21. (Ex. 4Kbp BamHI → 3 + 1 Kbp).

7 → 3 + 4

9→2 + 7

EcoRI / 8.9 kb
BamHI / 6 kb. 2.9 kb
HindIII / 8.9 kb
EcoRI + BamHI / 6 kb, 2.4 kb, 0.5 kb
EcoRI + HindIII / 7.4 kb, 1.5 kb
BamHI + HindIII / 5 kb, 2.9 kb, 1 kb
BamHI + EcoRI+ HindIII / 5 kb, 2.4 kb, 1 kb, 0.5 kb

23.An 8.9 kb circular plasmid is digested with three restriction enzymes, EcoRI, BamHI and HindIII, individually and in combination, and the resulting fragment sizes are determined by means of electrophoresis. The results are as follows:

Draw a possible restriction map based on these results.Set the EcoRI site as the origin.

Any rotation and mirror image of this map are valid.

24.Obtain the picture of the agarose gel electrophoresis of digests of the plasmid pBR322. (The file can be found on the course’s web site under the rubric “Sequences>pBR322”. Based on the results obtained, answer the following questions:

a.How many times did PvuII cut within the plasmid?

once

b.How many times did HincII cut within the plasmid?

twice

c.How many times did HincII cut within the PvuII fragment?

twice

d.What are the distances between the PvuII and the HincII sites?

Approx. 1415 & 1840

Lab exercise

(4 points/question)

Dilutions exercise with micropipettors (Pg. 13)

1.Indicate the absorbance readings obtained for each of the following solutions which you prepared in the first lab exercise. If you are submitting the assignment as a group of 2, indicate the average absorbance for both samples.

A 1.5mM solution of compound “A”.
A 0.36% (m/v) solution of compound “B”.
A 6% (v/v) solution of solution I.
A solution containing 0.5mg of compound “A” and 0.1% (v/v) of compound “B”.
A solution representing the following ratio: solution I: solution II : water : 2:1:2

Should be within 25% of the following values to obtain points:

a. 0.285b. 0.094c. 0.15d. 0.075e. 1.1

Determining DNA concentration:(Pg. 14)

2.Submit a table of the DNA concentration determinations experiment performed on page 14 of the lab manual. Your table should include the following information: Standard DNA concentrations (µg/mL), corresponding A260 readings, and A260 readings of each of the unknown diluted solutions of DNA you prepared.

Check general directives. Verify that absorbance readings are consistent with the dilution.

3.Submit a graph representing the A260 readings Vs standard DNA concentrations. Include a line of best fit, the R coefficient, and the formula of the line.

Check general directives. R2 coefficient should be greater than 0.95

4.Determine from your graph, what DNA concentration in µg/mL corresponds to an A260 of 1.0.

Accept anything in agreement with their graph

5.According to the constant determined in the previous question, what was the DNA concentration of the undiluted unknown DNA solution provided?

Accept anything in agreement with their ans. for previous question

Restriction digests & agarose gel electrophoresis (Pg. 15-17)

6.Submit a figure and an appropriate figure legend of the agarose gel described on page 17 of the lab manual.Check general directives.

7.Submit a standard curve of the molecular weight ladder (Migration distanceVs. Size in Kbp)

Check general directives.

8.Submit a table of the restriction digests of the recombinant plasmid which includes the following information: Enzyme used, number of cuts, fragment sizes observed.

Check general directives.

9.In a caption accompanying the table submitted, indicate the total size of the plasmid, the size of the vector, the size of the insert, and the restriction site (s) in which the insert was introduced in the vector.

Check general directives.

10.Provide a figure which represents a possible restriction map of the insert within the multiple cloning site of pUC9. Your map should be linear and only include the insert within the multiple cloning site. (See directives on this course’s web site)

Bioinformatics 1

11.Submit a table with the following information with regards to each of the unknown genes from the first bioinformatics exercise. (6 points)

The accession number (#2)
Coverage
Ident.
E value
The definition (#1)
The organism from which this sequence was obtained (#3)
The product of the gene (#4)
The protein id. This is the protein’s accession number (#5)

Accession number / Coverage / Ident / E value / Definition / Organism / Gene product / Protein id
NM_011882 / 100% / 100% / 0.0 / Mus musculus ribonuclease L / Mus musculus / Rnasel / NP_036012.1
XM_001122124 / 100% / 100% / 0.0 / Apis mellifera bluestreak (blue) / Apis mellifera / blue / XP_001122124.2
AY154834 / 30% / 100% / 0.0 / alcohol dehydrogenase 1 / Drosophila mojavensis / Adh-1 / AAN86870.1
NM_005109 / 100% / 100% / 0.0 / oxidative stress responsive 1 / Homo sapiens / OXSR1 / NP_005100.1
X01108 / 25% / 100% / 0.0 / cytochrome oxidase subunit II (CO II) / Triticum aestivum / cytochrome oxidase subunit II / CAA25581.1

12.Submit a printout of a FASTA sequence of one of the unknown genes. Include the name of the gene as a heading to the printout. (2 points)

Give points if provided

Assignment #2

Restriction digests and mapping (4 points/question)

The table below presents the results of different digests of a plasmid.

HindIII / 3.82, 0.18
BamHI / 4.0, 2.35, 1.65
EcoRI / 3.0, 1.0
HindIII + BamHI / 3.55, 2.35, 1.2, 0.27, 0.18
HindIII + EcoRI / 1.87, 1.0, 0.95, 0.18
BamHI + EcoRI / 1.6, 1.4, 1.0, 0.75, 0.25

1.What is the total plasmid size? 4Kbp

2.Which of the digests is (are) inconsistent with the other results? Give a possible explanation for the inconsistency indicating which fragment size (s) is (are) in disagreement.Partial; the size adds up to more than the total size of 4Kbp. 4Kbp band is a partial.

3.Draw a circular map which is in agreement with the results presented.

4.Given that 1µg of DNA was used for the EcoRI digest, what are the approximate quantities in µg of each of the fragments?

3.0Kbp: 0.75µg and 1.0Kbp:0.25µg

5.The restriction enzyme ApoI cleaves the sequence R/AATTY (R= A or G and Y = C or T). How many different palindromes does ApoI recognize?2

6.A DNA fragment generated with the restriction enzyme XbaI (T/CTAGA) was inserted into the unique NheI (G/CTAGC) site of a vector. Indicate the new 6 base sequence generated following ligation of the XbaI site to the NheI site.Accept either GCTAGA or TCTAGC

7.Could the new recombinant plasmid described in the previous question be digested with XbaI, NheI, or both enzymes to release the insert? Could not be release with any.

You performed restriction digests and agarose gel electrophoresis of a plasmid using 3 different restriction enzymes. The gel is shown below. Unfortunately, you forgot to label your tubes. The only things you remember is that your standards are in Lane 5 and your uncut control is in Lane 1. Also, you loaded the same amount of total DNA in all the sample wells (1-4).

8.What is the approximate size of the plasmid?

20 kb
16 kb
6.5 kb
5.0 kb

9.How many restriction sites are there in the plasmid for the enzyme used in Lane 2?

10.How many restriction sites are there in the plasmid for the enzyme used in Lane 4?

11.What is the most probable size of the band labelled with a star in lane 4?

14kbp

PCR

Consider the following information to answer questions 12-15:(4 points/question)

You wish to amplify a 1 Kbp single copy sequence from 1 µg of a single stranded genome which is 109 Kbp using a pair of primers “A” and “B”.

12.What is the minimum number of cycles required to obtain a double stranded amplification product delimited by primers “A” and “B”? 3

13.What mass of the double stranded PCR product (in µg) delimited by primers “A” and “B” would you have after the number of cycles indicated in the previous question?2 x 10-9µg

14.What mass of the double stranded PCR product (in µg) delimited by primers “A” and “B” would you have after a total of 30?Approx.0.27µg

15.How many additional PCR cycles would be required to attain the same yield of product which was obtained with 1 µg of genomic DNA if you had started with 1 ng of genomic DNA? Approx. 10

Consider the following information to answer questions 16-19:(4 points/question)

Below is the partial sequence of a 2Kbp region of DNA you wish to amplify and clone in the vector pST18. Below the sequence is indicated the restriction information for the sequence you wish to amplify as determined from a bioinformatics analysis as well as the MCS of pST18.

Restriction enz. / Number of cuts / Position
BamHI (G/GATCC) / 2 / 26 & 1615
BclI (T/GATCA) / 0
EcoRI (G/AATTC) / 0
SfaA1 (GCGAT/CGC) / 1 / 540
XbaI (T/CTAGA) / 2 / 500 & 1500

16.The following sequence represents that of one of the primers designed to amplify and clone the desired sequence: 5'-GAATTCAGGGTCGGCTAT-3'. The underlined sequence represents an EcoRI restriction site. Indicate the sequence of the first 20 bases of the PCR product which would be synthesized from this primer (including the primer sequence)

5'-GAATTCAGGGTCGGCTATCC

17.Design a second 15 bases primer, which in combination with the one described in the previous question would allow the amplification of the desired region. Include in your primer sequence a restriction site which would allow the directional cloning of the sequence of interest. (Note, the restriction site must be additional to the 15 bases. Underline the sequence of the restriction site and indicate its identity.

BclI

5’-T/GATCA GACTGAATGCCACAC

18.Your primers allowed you to amplify a 2 Kbp sequence. You digest the amplicon and 100ng of the vector with the appropriate enzymes in order to clone the sequence of interest. How much of the digested amplicon should be added to the ligation mix in order to have an insert to vector ration of 3:1?200ng

19.Following the ligation, you isolate plasmid DNA from a potential recombinant. What digest could be used to verify the presence and the orientation of the desired insert. Indicate the enzyme (s) and the fragment size (s) expected if this is the desired recombinant.

XbaI:3.5, 1, and 0.5Kb

Lab exercise

Project I: Verifying the restriction map of a DNA insert (4 points/question)

1.Submit a figure representing the agarose gel electrophoresis of your single digests. Make sure to include an appropriate legend. Follow the directives for figures on the web page of this course. Make sure to include all the required information in the legend for the understanding and interpretation of the figure.

Check general directives. Should be similar to this depending on the orientation they had:

2.Submit a figure representing the agarose gel electrophoresis of your double digests. Make sure to include an appropriate legend. Follow the directives for figures on the web page of this course. Make sure to include all the required information in the legend for the understanding and interpretation of the figure. Check general directives.

3.Submit a table presenting the analysis of the restriction digests. Your table should include: Enzyme (s) used, Total number of cuts, Number of cuts in the vector, Number of cuts in the insert, and Fragments sizes generated. Check general directives.

4.Submit a figure of the restriction map of the insert. Your map must be linear, include the multiple cloning site, indicate the insertion site, the size of the insert, the positions in the multiple cloning site or the insert of all the enzymes tested. Your figure must be to scale. Follow the directives for generating such a figure under the heading Graphs/Figures on this course's web site. Check general directives.

Bioinformatics 2(1 point/question)

Restriction mapping

5.Present theoretical maps of all unknown genes. Indicate below each map the name of the gene and list the enzymes which do not cut. Give points if done and required info is given.

6.Compare the theoretical maps generated above to the experimental map of the unknown insert you analyzed in Project I. The unknown insert corresponds most closely to which gene?CoxII

7.Submit a printout of the FASTA sequence of the gene corresponding to the unknown insert.Give points if done

8.Indicate how many times each of the following enzymes cut within the unknown insert identified in question 6: AccI (2), BglII (0), MboI (18), NcoI (1), and NotI (0).

9.Amongst the enzymes indicated in the previous question, which one cuts the most often within the DNA insert? Give a reason which would explain why this enzyme cuts more often than the others.MboI, recognition sequence is only 4 bases therefore more probable than others which are 6 - 8 bases.

Bioinformatics 3 (1 point/question)

10.What is the predicted size of the GFP product amplified with the primers used in lab exercise 2?487bp

11.Submit a figure showing the positions and directions of each of the following primers on the pUC19 sequence.

A.TGCGGTGTGAAATACCCT

B.GCCATTCAGGCTGCGCAA

C.GGGTTATTGTCTCATGAG

D.GAGACAATAACCCTGATA

Indicate in a legend to your figure all primer pairs, if any, would give an amplification product of at least 200bp.

B and D give a product of at least 200bp

12.Present the complement, inverse, inverse complement and the complement of the inverse of the following sequence:

5’- GAATGCGGCTTAGACTGGTACGATGGAAC-3’

Complement: 3’CTTACGCCGAATCTGACCATGCTACCTTG

Inverse: 5’CAAGGTAGCATGGTCAGATTCGGCGTAAG