Supplementary Fig. S1

Fig S1.Comparison of origin sequences and optimized sequences of PcGDH. The black areas represent the same nucleotide sequences and the white areas represent the optimized nucleotide sequence, but the whole amino acid sequences were not changed.

Supplementary Fig S2

Fig S2.Phylogenetic relationship withinbacterial, fungal, and higherplant GDH amino acidsequences.aThechart shows relationships among the NADP(H)-GDHs forAspergillus nigerACJ03788, Aspergillus nidulans XP661980, Neurospora intermediaAAG01158,Escherichia coliNP416275,SolanumlycopersicumP93541, Chlorella sorokinianaCAA41635, Arabidopsis thaliana At1g51720 and Oryza sativaOs01g37760and theNAD(P)(H)-GDH2sofArabidopsis thaliana At5g07440 and Oryza sativaOs02g43470.Phylogenetic tree analysis was performed using MEGA 5. bWholeamino acid sequence comparison of GDH from Pleurotus cystidiosus(PcGDH),Aspergillus niger(gdhA),Aspergillus nidulans(gdhA),Neurospora intermedia (NiGDH), Escherichia coli(EcGDH),Arabidopsis(AtGDH) andrice (OsGDH).Thedouble black lines indicate Glu/2-OG binding siteandblack line indicates the NAD(P) binding site.The identical amino acidsare indicated by grey and black boxes, respectively. Protein names are indicated at the left.

Supplementary Fig S3

Fig S3.Genetic analysis of T1 transformants.aPcGDHgene were cloned from the cDNA ofPleurotus cystidiosus.b The PcGDH gene was identified betweencontrol and T1 transformants in rice genomic DNA.cOver-expression analysis by RT-PCR in shoots of control and T1 transformants.Actin was used as a control for mRNA levels.

Supplementary Fig S4

Fig S4.Mendelian inheritance analysis in T1germinated seeds.aThe red fluorescence screening of germinated seeds ofcontrol (nontransformants). The seeds showed nored fluorescence.b The red fluorescence screening of T1 germinated seeds of transformants (Ubi::PcGDH-12).The white arrowheadrepresentsseeds withoutred fluorescence, and the red arrowheadrepresents seeds withred fluorescence.cHygromycin resistance analysis of T1germinated seedsofcontrol (nontransformants) and transformants(Ubi::PcGDH-12).

Supplementary Table S1Primers for overlap PCR analysis

Primer name / Sequence (5'-3')
PcGDH-1F / GCCACCATGTCCCACCTGCCTTTCG
PcGDH-1R / CGCATTCTTGAAGATCTGCTCA
PcGDH-2F / TGAGCAGATCTTCAAGAATGCG
PcGDH-2R / CTTTGCCTCCTCGCCAGAA
PcGDH-3F / TTCTGGCGAGGAGGCAAAG
PcGDH-3R / CCCCACCAATCTCCGTGGTCG

The underline indicates thekozark sequence and the bold partsindicate mutated nucleotide.

Supplemental Table S2Kinetic property of purified PcGDH of Pleurotuscystidiosus

Substrate / Km(mM)
NH4+ / 3.73±0.23
2-oxoglutarate / 13.27±0.53
NADPH / 1.10±0.06
Glutamate / 15.97±0.31
NADP+ / 0.12±0.005

The calculation was accomplished by using the Lineweaver-Burk double-reciprocal protocol. Values represent the means of three independent experiments. Data are presented as average values ± SD (n=3)

Supplemental Table S3Segregation of transgenic (resistant) and nontransgenic (susceptible) seedlings in the T1 plants.

Line no. / Number of resistant or red fluorescenceseedlings / Number of susceptible or have not red fluorescenceseedlings / χ2 value / P value
Ubi::PcGDH-5(red) / 46 / 14 / 0.089 / 0.766 a
Ubi::PcGDH-5(hyg) / 131 / 45 / 0.03 / 0.862 a
Ubi::PcGDH-10(red) / 44 / 25 / 4.643 / 0.031
Ubi::PcGDH-10(hyg) / 95 / 48 / 5.597 / 0.018
Ubi::PcGDH-12(red) / 53 / 16 / 0.121 / 0.728 a
Ubi::PcGDH-12(hyg) / 154 / 55 / 0.193 / 0.660 a
Ubi::PcGDH-13(red) / 41 / 29 / 10.076 / 0.002
Ubi::PcGDH-13(hyg) / 124 / 63 / 7.531 / 0.006
Ubi::PcGDH-15(red) / 34 / 21 / 5.097 / 0.024
Ubi::PcGDH-15(hyg) / 134 / 65 / 6.233 / 0.013

Line no. were the progenies transformed by pCAMBIA1301GW-PcGDH and selected by 150mg/L hygromycin and RFP analysis.

aThe segregation fit the expected 3:1 ratio.