Supplementary Methods

Reagents and primary antibodies

CORT and DEX were obtained from Sigma-Aldrich (St. Louis, MO, USA).Blebbistatin was from Merck (Whitehouse Station, NJ, USA). The primary antibodies were as follows: anti-ezrin and anti--tubulin antibodies were purchased from Sigma-Aldrich. Anti-DCLK1, anti-GR, anti-non-muscle myosin IIA, anti-non-muscle heavy chain myosin (myosin IIB), and anti-doublecortin antibodies were from Abcam (Cambridge, UK). Anti-adducin γ, anti-plastin 3, andanti-myosin 1e antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). We also purchased anti-GFP (Invitrogen,Carlsbad, CA, USA), anti-βIII-tubulin (Covance, Princeton, NJ, USA), anti-HA (Roche, Basel, Swiss), and anti-BrdU (Dako, Copenhagen, Denmark) antibodies. The anti-CaD and anti-gelsolin antibodies were generated as previously described.1, 2

Reporter assays

The transcription start sites of the fibroblast- and HeLa-type promoters of the rat CALD1 gene were determined by RNA ligation–mediated rapid amplification of cDNA ends (RLM-RACE) using a GeneRacer kit (Invitrogen). The fibroblast-type (-1475 to +105) and HeLa-type (-2075 to +132) promoter regions of the rat CALD1 gene were amplified by PCR and cloned into pGL3-basic. For the mutant constructs, several substitutions were introduced into the CArG-box or the two GRE sequences of the fibroblast-type promoter as follows: for CArG, CCAAAAAAGGAAAAAAAAGG; for GRE 1, TGTTCACTTAGCATGGA TATTAACTTAAAATTTA; for GRE 2, AGAGAGCAGTGTGCGTTAAGATATTAGTATGCGTTA. The NPCs were transfected with these constructs and pGL3--gal, for normalization of the transfection efficiency. In some experiments, cells were co-transfected with pCAGGS-hGRC-cFLAG. Twenty-four hours after transfection, cells were lysed with Passive Lysis Buffer (Promega, Madison, WI, USA), and the luciferase and -galactosidase activities were measured using the Luciferase Assay System (Promega) and Luminescent -galactosidase detection kit II (Clontech, Mountain View, CA, USA), respectively. Luciferase activities were normalized to the β-galactosidase activity in this study.

DNA-binding assay

Human GRα-c-FLAG was synthesized using the TnT high yield in vitro transcription/translation system (Promega) and precleared with Dynal Dynabeads M280 streptavidin (Invitrogen).The oligonucleotides for CaDGRE1 (Biotin-GGGTATGTGTTCACTTAGCATGGACTTCTG and CAGAAGTCCATGCTAAGTGAACACATACCC), CaDGRE1mut (Biotin-GGGTATGTATTAACTTAAAATTTACTTCTG and CAGAAGTAAATTTTAAGTTAATACATACCC), CaDGRE2 (Biotin-TTGAATAGAGAGCAGTGTGCGTTAGGCTGC and GCAGCCTAACGCACACTGCTCTCTATTCAA), and CaDGRE2mut (Biotin-TTGAATAGATATTAGTATGCGTTAGGCTGC and GCAGCCTAACGCATACTAATATCTATTCAA) were annealed and used as affinity probes. The synthesized proteins were incubated with 1 g of biotinylated-DNA fragment in DNA-binding buffer [20 mM HEPES-KOH pH 7.9, 80 mM KCl, 1 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 10 glycerol, 0.1 Triton X-100, 50 g/ml herring sperm DNA, 1 protease inhibitor cocktail (Nacalai Tesque, Kyoto, Japan)] at 4C for 1.5 hr. The Dynabeads were then added to the reaction mixtures, which were then incubated at room temperature for 1 hr. After three washes with DNA-binding buffer, SDS-sample buffer was added to the Dynabeads mixture for SDS-PAGE.

Rac activationassay

A pulldown assay for the active form of Rac was performed using the EZ-DetectTMRac1 Activation Kit (Thermo Fisher Scientific, Waltham, MA, USA). NPCs were treated with DMSO or 1 M CORT for 48 hours and 10 µM blebbistatinfor 24 hours. Then, according to the protocol, the pulled-down active form of Rac isolated from these lysates was detected by Western blots.

References

1. Tanaka J, WatanabeT, NakamuraN, Sobue K. Morphological and biochemical analyses of contractile proteins (actin, myosin, caldesmon and tropomyosin) in normal and transformed cells.J Cell Sci1991; 104: 595-606.

2. Tanaka J, Sobue K. Localization and characterization of gelsolin in nervous tissues: gelsolin is specifically enriched in myelin-forming cells. 1994; J Neurosci14: 1038-1052.

Supplementary Movie Legends

Supplementary Movie 1

Time-lapse images of cultured NPCs treated with DMSO (left side) or 1μM CORT (right side). The movie was taken for 1 hour with 3-minute intervals. Scale bar, 20 m.

Supplementary Movie 2

Time-lapse images of GFP- (left side) or GFP-CaD- (right side) expressing NPCs. The movie was taken for 1 hour with 2-minute intervals. Scale bar, 20m.

Supplementary Movie 3

Time-lapse images of DMSO- (left side) or blebbistatin- (right side) treated NPCs. The movie was taken for 1 hour with 3-minute intervals. Scale bar, 20m.

1