electronic supplementary material

SEDIMENTS, SEC 4 • SEDIMENT-ECOLOGY INTERACTIONS • RESEARCH ARTICLE

Anthropogenic activities drive the microbial community and its function in urban river sediment

Xu Zhang • Qing Gu • Xi-En Long • Zhao-Lei Li • Dong-Xiu Liu • Dan-Hua Ye • Chi-Quan He • Xiao-Yan Liu • KristiinaVäänänen • Xue-Ping Chen

Received: 31 October 2014 / Accepted: 16 August 2015

© Springer-Verlag 2015

Responsible editor: John R. Lawrence

X. Zhang • D.-X.Liu • D.-H.Ye • C.-Q.He • X.-Y.Liu • X.-P. Chen ()

School of Environmental and Chemical Engineering, Shanghai University, Shanghai 200444, China

e-mail:

Q. Gu

Zhejiang Environmental Monitoring Center, Hangzhou 310015, China

X.-E. Long

Institute of Urban Environment, Chinese Academy of Sciences, Xiamen, China

Z.-L. Li

Coastal Ecosystems Research Station of the Yangtze River Estuary, Ministry of Education Key Laboratory for Biodiversity and Ecological Engineering, Institute of Biodiversity Science, Fudan University, Shanghai 200433, China

K. Väänänen

Department of Biology, University of Eastern Finland, Joensuu 80101, Finland

() Corresponding author:

Xue-Ping Chen

Tel.: +86 21 66137746

Fax: +86 21 66137756

e-mail:

Table S1 Location, environmental status and several important hydrological characteristics of the study sites (n=3)

Sampling site / Longitude/ latitude / Description / Physicochemical properties
Particle size distribution (%) / pH / T
(°C) / DO
(mg L-1) / NH3-N
(mg L-1) / TN
(mg L-1) / TP
(mg L-1) / CODCr
(mg L-1) / CODMn
(mg L-1) / BOD
(mg L-1)
<3.9 μm / 3.9-63μm / >63
μm
YQ / 120.69312/
30.54102 / Receives runoff from residential (commercial and urban land) areas, high road density / 30.7 / 40.0 / 29.3 / 7.13±0.16 / 27.0 / 3.47±0.26 / 1.28±0.045 / 3.75±0.17 / 0.321±0.024 / 24.2±0.56 / 7.42±0.20 / 7.9±0.53
BY / 120.70813/
30.53289 / 29.5 / 32.7 / 37.8 / 7.04±0.05 / 25.3 / 2.18±0.10 / 0.721±0.035 / 3.65±0.12 / 0.347±0.072 / 20.2±0.31 / 6.40±0.08 / 5.5±0.85
DS / 120.7025/
30.54013 / 41.1 / 44.2 / 14.7 / 7.19±0.03 / 25.4 / 1.72±0.17 / 0.547±0.030 / 2.79±0.16 / 0.258±0.014 / 20.1±0.87 / 6.21±0.12 / 5.1±0.61
CST / 120.69939/
30.54629 / 41.2 / 48.7 / 10.1 / 7.32±0.03 / 25.5 / 1.68±0.17 / 0.530±0.068 / 2.48±0.17 / 0.260±0.011 / 23.9±1.06 / 6.96±0.13 / 5.0±0.59
DYT / 120.69568/
30.54944 / Receives runoff from agricultural andtransportation areas / 39.1 / 54.3 / 6.6 / 7.15±0.01 / 27.3 / 3.22±0.09 / 0.537±0.032 / 2.98±0.16 / 0.371±0.01 / 23.9±0.62 / 7.52±0.19 / 5.1±0.27
GT / 120.70058/
30.56716 / 37.3 / 54.2 / 8.5 / 7.33±0.13 / 26.7 / 5.05±0.39 / 0.170±0.021 / 2.90±0.15 / 0.476±0.037 / 27.2±2.00 / 9.62±0.11 / 2.5±0.70
SD / 120.69818/
30.55876
/ 33.5 / 26.4 / 40.1 / 7.38±0.05 / 27.2 / 3.00±0.12 / 0.512±0.029 / 2.96±0.11 / 0.334±0.009 / 21.3±0.65 / 6.53±0.31 / 4.1±0.75
LH / 120.65967/
30.56511 / 31.0 / 61.9 / 7.1 / 7.32±0.02 / 27.4 / 5.05±0.10 / 0.436±0.014 / 3.26±0.08 / 0.366±0.016 / 22.9±0.42 / 7.07±0.13 / 4.0±0.40
BHQ / 120.67079/
30.5596 / Industrial regions with sewage (from leatherprocessing, dyeing) / 33.8 / 58.1 / 8.1 / 7.13±0.02 / 27.4 / 2.90±0.08 / 0.391±0.018 / 2.98±0.10 / 0.326±0.006 / 23.1±0.36 / 6.77±0.14 / 3.2±0.87
SX / 120.69163/
30.5501 / 26.9 / 34.8 / 38.4 / 7.15±0.06 / 27.3 / 3.50±0.28 / 0.572±0.011 / 3.03±0.15 / 0.330±0.014 / 21.9±0.15 / 6.59±0.29 / 4.2±0.87
SMY / 120.72961/
30.5286 / 41.8 / 38.5 / 19.6 / 7.16± / 25.9 / 3.47±0.15 / 0.701±0.088 / 4.11±0.11 / 0.494±0.029 / 21.0±0.67 / 6.12±0.61 / 5.8±0.95

Table S1 (Continued)

Sampling
site / Physicochemical properties
S2-(mg L-1) / F-(mg L-1) / Phenol(μgL-1) / Arsenic(μgL-1) / Petroteum(mg L-1) / Chloride(mg L-1) / Selenium(mg L-1)
YQ / 0.032±0.004 / 0.485±0.023 / 1.43±0.259 / 0.228±0.011 / 0.343±0.029 / 0.482±0.014 / 0.283±0.015
BY / 0.035±0.001 / 0.600±0.312 / 1.12±0.181 / 0.223±0.006 / 0.307±0.025 / 0.590±0.038 / 0.227±0.006
DS / 0.034±0.001 / 0.579±0.021 / 2.42±0.142 / 0.207±0.012 / 0.353±0.021 / 0.570±0.024 / 0.267±0.021
CST / 0.033±0.002 / 0.576±0.012 / 1.14±0.042 / 0.227±0.015 / 0.440±0.046 / 0.548±0.028 / 0.277±0.012
DYT / 0.037±0.002 / 0.623±0.017 / 1.71±0.104 / 0.217±0.012 / 5.507±0.151 / 0.623±0.012 / 0.250±0.020
GT / 0.034±0.004 / 0.556±0.023 / 0.93±0.051 / 0.230±0.017 / 0.123±0.038 / 0.506±0.063 / 0.270±0.010
SD / 0.033±0.002 / 0.603±0.005 / 1.41±0.091 / 0.230±0.026 / 0.413±0.031 / 0.597±0.020 / 0.273±0.021
LH / 0.034±0.003 / 0.525±0.004 / 1.13±0.139 / 0.227±0.006 / 0.143±±0.035 / 0.535±0.023 / 0.217±0.006
BHQ / 0.033±0.001 / 0.534±0.010 / 1.04±0.086 / 0.213±0.006 / 0.267±0.012 / 0.532±0.017 / 0.293±0.021
SX / 0.037±0.001 / 0.548±0.017 / 1.03±0.290 / 0.283±0.049 / 0.273±0.144 / 0.514±0.066 / 0.290±0.017
SMY / 0.037±0.002 / 0.567±0.010 / 1.12±0.061 / 0.237±0.038 / 0.103±0.012 / 0.564±0.021 / 0.267±0.012

TableS2 Q-PCR parameters and results

Genes / Primer / Sequence (5’-3’) / Reference / Thermal profile for quantitative PCR / Standard curve
Carbon cycle / mcrA / MLF
MLR / GGTGGTGTMGGATTCACACART
AYGCWACAGC
TTCATTGCRTAGTTWGGRTAGTT / Luton et al., 2002 / 3 min at 95.0°C, followed by 40 cycles of 30 s at 95.0°C, 30 s at 55.0°C, and 45 s at72.0°C; fluorescence was read during each cycle at 83°C / R2=0.993
l=-3.3323
E=98.9%
pmoA / A189
Mb_661 / GGNGACTGGGACTTCTGG
CCGGMGCAACGTCYTTACC / Lin et al., 2005 / 3 min at 95.0°C, followed by 40 cycles of 30 s at 95.0°C, 30 s at 55.0°C, and 45 s at72.0°C; fluorescence was read during each cycle at 83°C / R2=0.9942
l=-3.175
E=106%
Nitrogen cycle / nifH / PolF
PolR / TGCGAYCCSAARGCBGACTC ATSGCCATCATYTCRCCGGA / Poly et al., 2001 / 3 min at 95.0°C, followed by 40 cycles of 30 s at 95.0°C, 30 s at 55.0°C, and 45 s at72.0°C; fluorescence was read during each cycle at 83°C / R2=0.9962
l=-3.0591
E=112%
nirK / F1aCU
R3CU / ATCATGGTSCTGCCGCG GCCTCGATCAGRTTGTGGTT / Henry et al., 2004 / 3 min at 95.0°C, followed by 40 cycles of 30 s at 95.0°C, 30 s at 55.0°C, and 45 s at72.0°C; fluorescence was read during each cycle at 83°C / R2=0.9906
l=-3.3837
E=97.5%
nirS / cd3aF
R3cd / GTSAACGTSAAGGARACSGG GASTTCGGRTGSGTCTTGA / Throback et al., 2004 / 3 min at 95.0°C, followed by 40 cycles of 30 s at 95.0°C, 30 s at 55.0°C, and 45 s at
72.0°C; fluorescence was read during each cycle at 83°C / R2=0.9965
l=-3.1545
E=107%
ArchaeaamoA（AOA） / Arch-amoAF
Arch-amoAR / STAATGGTCTGGCTTAGACG GCGGCCATCCATCTGTATGT / Francis et al. 2005 / 3 min at 95.0°C, followed by 40 cycles of 30 s at 94.0°C, 30 s at 59.0°C, and 45 s at72.0°C; fluorescence was read during each cycle at 83°C / R2=0.999
l=-3.1062
E=110%
Bacteria
amoA
(AOB) / amoA-1F amoA-2R / GGGGTTTCTACTGGTGGT CCCCTCKGSAAAGCCTTCTTC / Rotthauwe et al., 1997 / 3 min at 95.0°C, followed by 40 cycles of 30 s at 94.0°C, 30 s at 55.0°C, and 45 s at72.0°C; fluorescence was read during each cycle at 83°C / R2=0.9934
l=-3.3325
E=98.5%
nosZ / nosZ-F
nosZ1622R / CGYTGTTCMTCGACAGCCAG
CGSACCTTSTTGCCSTYGCG / Henry et al., 2006 / 3 min at 95.0°C, followed by 40 cycles of 30 s at 94.0°C, 30 s at 60.0°C, and 45 s at72.0°C; fluorescence was read during each cycle at 83°C / R2=0.9962
l=-3.4641
E=94.4%
Sulfate reduction / dsrB / DSRp2060F
DSR4R / CAACATCGTYCAYACCCAGGG
GTGTAGCAGTTACCGCA / Geets et al., 2006 / 3 min at 95.0°C, followed by 40 cycles of 30 s at 94.0°C, 45 s at 56.0°C, and 45 s at72.0°C; fluorescence was read during each cycle at 83°C / R2=0.9804
l=-3.4937
E=104.3%

Fig.S1 Heatmap of 16SrRNA gene sequences obtained from river sediment distributed in the residential, agricultural and industrial zones, respectively. The samples are indicated as the abbreviation of site, and the color of the sample names denote the residential (green), agricultural (blue) and industrial (red). Only bacteria species with a sum of >1% assigned sequences across all samples were used for further log10+1 transformation. The top dendrogram is based on Euclidean distances and represents clustering into two distinct clusters according to relative abundances within the data matrix. Cluster I (left) contains the samples originating from the center of the town across three zones, and cluster II (right) contains the samples taken from suburban district