Transcriptomic and Proteomic Analysis Reveals Mechanisms of Embryo Abortion During

Transcriptomic and proteomic analysis reveals mechanisms of embryo abortion during chrysanthemum cross breeding

Fengjiao Zhang, Zhiquan Wang, Wen Dong, Chunqing Sun, Haibin Wang, Aiping Song, Lizhong He, Weimin Fang, Fadi Chen, Nianjun Teng

Supplementary Information

SupplementaryTable S1. The 129 KEGG pathways.

SupplementaryTable S2 Differential expression genes in normal (NE12) and abortive (AE18) chrysanthemum embryos.

SupplementaryTable S3 Differential expression genes in normal (NE18) and abortive (AE18) chrysanthemum embryos.

SupplementaryTable S4. Differentially expressed genes in normal and abortive chrysanthemum embryos.

SupplementaryTable S5. Primer sequences for qRT-PCR.

SupplementaryFig. S1. Clusters of orthologous groups (COG) function classification of chrysanthemum embryo transcriptome. The 25,297 sequences were grouped into 25 categories.

SupplementaryFig. S2. Gene Ontology (GO) classifications of chrysanthemum embryo transcriptome. The transcriptome datasets are grouped into three categories: biological process, cellular component and molecular function.

SupplementaryFig. S3. Differentially expressed genes among transcriptome datasets. The number of up- (a) and down-regulated (b) genes between AE18 and NE12, AE18 and NE18 are summarised. Complete information for each gene list can be found in Tables S2 & S3. (All Venn diagrams produced by Venny28).

SupplementaryFig. S4. The workflow for transcriptomic analysis of chrysanthemum embryos.

SupplementaryFig. S5. The workflow for proteomic analysis of chrysanthemum embryos.

Fig. S1 Clusters of orthologous groups (COG) function classification of chrysanthemum embryo transcriptome

Fig. S2 Gene Ontology (GO) classifications of chrysanthemum embryo transcriptome

Fig. S3 Differentially expressed genes among transcriptome datasets

Fig. S4 The workflow for transcriptomic analysis of chrysanthemum embryos

Fig. S5 The workflow for proteomic analysis of chrysanthemum embryos

Table S4. Differential expression genes in normal and abortivechrysanthemum embryos

Genes ID / NE12 FPKM / NE18 FPKM / AE18 FPKM / Nr-annotation
Cell senescence and death
CL8107.Contig2_All / 3.08 / 8.14 / 17.74 / senescence-associated protein
CL3742.Contig7_All / 4.30 / 14.12 / 13.10 / senescence-related protein
CL8052.Contig3_All / 5.59 / 31.27 / 22.69 / senescence-related protein
Unigene23480_All / 10.90 / 34.67 / 27.68 / serine/threonine-protein kinase CTR1-like
Unigene31215_All / 14.52 / 80.55 / 68.14 / serine/threonine-protein kinase WNK11-like
CL7004.Contig3_All / 28.83 / 44.84 / 59.78 / caspase, putative
CL15915.Contig2_All / 2.43 / 5.75 / 5.54 / caspase, putative
Unigene29849_All / 2.75 / 7.91 / 7.39 / aspartic proteinase nepenthesin-2-like
Unigene31333_All / 4.76 / 10.74 / 3.67 / aspartic proteinase nepenthesin-1 precursor, putative
Unigene49135_All / 0.60 / 2.74 / 1.86 / lethal leaf spot 1-like protein
Unigene51752_All / 2.33 / 7.56 / 0.51 / aspartic proteinase
Unigene7475_All / 27.77 / 13.75 / 14.22 / apoptosis-inducing factor homolog A-like
Unigene13579_All / 1.62 / 5.03 / 4.43 / Cytochrome c
Unigene5306_All / 27.71 / 8.05 / 30.56 / Cytochrome c
Unigene2161_All / 172.46 / 372.90 / 345.67 / Cytochrome c
Unigene21484_All / 358.29 / 179.01 / 230.74 / cysteine protease
Unigene21604_All / 897.17 / 373.90 / 470.00 / cysteine protease
Unigene28134_All / 216.31 / 84.84 / 105.20 / cysteine proteinase
Unigene15193_All / 252.15 / 119.81 / 138.58 / cysteine protease
CL377.Contig5_All / 2.7297 / 0.5347 / 2.8369 / pathogenesis-related protein
Reactive oxygen species scavenger
CL5385.Contig1_All / 0.42 / 1.80 / 1.91 / peroxidase
Unigene9496_All / 2.23 / 4.37 / 7.37 / peroxidase
CL15040.Contig1_All / 4.18 / 13.24 / 16.11 / peroxidase
CL8422.Contig3_All / 11.01 / 37.54 / 38.27 / peroxidase
Unigene18167_All / 20.62 / 51.72 / 44.56 / peroxidase 31-like
Unigene21550_All / 2207.19 / 925.02 / 1124.31 / catalase
Unigene24749_All / 31.02 / 134.32 / 118.13 / ascorbate oxidase
CL14312.Contig1_All / 8.98 / 62.48 / 51.58 / L-ascorbate oxidase homolog
CL5541.Contig6_All / 1.96 / 8.30 / 6.25 / L-ascorbate oxidase homolog
Unigene7903_All / 0.99 / 1.73 / 3.75 / glutathione peroxidase
CL11780.Contig1_All / 41.35 / 20.07 / 23.34 / glutathione peroxidase 2
CL6269.Contig1_All / 150.59 / 544.16 / 406.46 / glutathione peroxidase 2
Unigene12018_All / 9.23 / 4.31 / 4.73 / dehydroascorbate reductase
Phytohormone signaling
Unigene29518_All / 2.55 / 1.06 / 0.99 / auxin-induced protein
Unigene29521_All / 2.70 / 1.35 / 0.96 / auxin-induced protein
Unigene40598_All / 6.81 / 1.43 / 0.46 / auxin response factor 4-like
CL3066.Contig5_All / 1.52 / 0.17 / 0.05 / auxin response factor, putative
CL12550.Contig2_All / 15.94 / 6.72 / 6.80 / auxin response factor, putative
Unigene3750_All / 12.30 / 10.04 / 3.82 / auxin-induced protein 5NG4, putative
Unigene2545_All / 5.83 / 9.63 / 13.31 / gibberellin-regulated family protein
Unigene31648_All / 10.89 / 44.12 / 1.51 / gibberellin 20-oxidase No3
CL3106.Contig4_All / 6.23 / 32.48 / 24.57 / gibberellin 2-oxidase No1
Unigene23347_All / 3.09 / 19.44 / 15.62 / gibberellin 2-oxidase
Unigene26909_All / 12.89 / 30.38 / 26.33 / gibberellin 2-oxidase
Unigene10574_All / 64.01 / 20.43 / 25.46 / ethylene responsive element binding protein C4
Unigene10399_All / 94.63 / 191.69 / 240.30 / ethylene responsive element binding protein C1
Unigene25739_All / 2.91 / 7.79 / 12.06 / ethylene-responsive transciptional coactivator-like protein
Unigene587_All / 11.03 / 59.41 / 48.09 / ethylene-responsive factor-like protein 1
Unigene22446_All / 5.97 / 1.31 / 1.11 / ethylene insensitive protein, putative
Cell division and expansion
Unigene24705_All / 42.2137 / 16.0515 / 13.8934 / expansin
Unigene14594_All / 23.3011 / 5.0287 / 5.7835 / putative expansin
Unigene8344_All / 11.47 / 2.66 / 3.04 / alpha-expansin 11 precursor, putative
Unigene27839_All / 9.40 / 58.64 / 25.87 / extensin-like protein
CL5976.Contig2_All / 7.08 / 29.64 / 1.01 / beta expansin 2 precursor
Unigene11714_All / 36.41 / 15.58 / 34.21 / Histone 3
CL3367.Contig4_All / 15.05 / 30.47 / 16.83 / Histone H3
CL9620.Contig1_All / 1.21 / 0.79 / 3.80 / Histone H3
CL9217.Contig2_All / 7.72 / 21.09 / 18.81 / Histone H2AX-like
Cytoskeleton
Unigene37701_All / 6.39 / 0.58 / 0.09 / cytoskeletal protein
Unigene35314_All / 9.49 / 0.20 / 0.28 / Guillardia theta ACT1 gene for actin 1
Unigene48753_All / 6.51 / 2.59 / 2.97 / actin related protein
Unigene3079_All / 1.36 / 0.18 / 0.75 / actin related protein
Unigene22260_All / 7.12 / 1.71 / 3.31 / actin
Unigene48739_All / 8.34 / 29.45 / 7.34 / actin
Unigene31578_All / 15.46 / 4.18 / 3.38 / cytoplasmic dynein light chain, putative
Unigene8380_All / 34.02 / 10.04 / 16.73 / tubulin beta chain, putative
Energy metabolism
Unigene38257_All / 17.63 / 0.34 / 0.28 / ATP synthase subunit alpha
Unigene43190_All / 5.54 / 0.00 / 0.00 / ATPase subunit 6
Unigene43385_All / 4.01 / 0.00 / 0.00 / ATPase subunit 9
CL3950.Contig10_All / 2.62 / 0.85 / 0.77 / plasma membrane H+ ATPase
Unigene34992_All / 4.88 / 1.76 / 1.23 / plasma membrane H+ ATPase
CL5835.Contig1_All / 4.88 / 1.65 / 5.36 / aconitate hydratase, mitochondrial
CL14726.Contig2_All / 6.28 / 3.15 / 2.66 / UDP-glucose 4-epimerase
CL12522.Contig1_All / 2.90 / 5.03 / 7.04 / UDP-glucose crocetin glucosyltransferase
CL862.Contig2_All / 0.50 / 1.57 / 0.98 / pyruvate kinase, cytosolic isozyme-like
Unigene51682_All / 0.00 / 4.16 / 0.19 / pyruvate kinase
CL11733.Contig2_All / 1.9832 / 1.5665 / 0.9369 / pyruvate kinase
Unigene15994_All / 0.14 / 7.51 / 4.92 / 2-succinylbenzoate-CoA ligase
CL3082.Contig5_All / 43.65 / 22.88 / 21.70 / phosphoenolpyruvate carboxykinase
Unigene13910_All / 13.59 / 56.12 / 37.28 / vacuolar proton translocating ATPase 100 kDa subunit
CL9471.Contig1_All / 19.39 / 44.60 / 55.25 / phospholipid-transporting ATPase 1-like
Unigene8208_All / 11.11 / 29.01 / 38.12 / phospholipid-translocating P-type ATPase flippase family protein
CL7696.Contig7_All / 1.65 / 7.09 / 8.20 / type IIB calcium ATPase MCA5
CL4695.Contig1_All / 4.40 / 32.90 / 33.64 / calcium-transporting ATPase 12, plasma membrane-type-like
Unigene3738_All / 11.11 / 35.92 / 34.31 / calcium-transporting ATPase 12, plasma membrane-type-like
Unigene55850_All / 7.51 / 27.16 / 26.72 / calcium-transporting ATPase 12, plasma membrane-type-like
Protein synthesis
Unigene26963_All / 9.99 / 40.12 / 4.62 / late embryogenesis abundant protein group 9 protein
Unigene25222_All / 7.32 / 29.72 / 1.58 / late embryogenesis abundant protein-like
Unigene13976_All / 17.61 / 54.00 / 6.92 / late embryogenesis abundant protein
Unigene20511_All / 2.41 / 17.57 / 1.57 / vegetative cell wall protein gp1 precursor, putative
Unigene27790_All / 4.94 / 13.93 / 1.49 / transcription activator-related protein
Unigene51655_All / 0.79 / 20.44 / 0.42 / ubiquitin-60S ribosomal protein L40
Unigene48142_All / 0.55 / 9.67 / 0.21 / 60S ribosomal protein L12
Unigene48132_All / 0.20 / 3.84 / 0.00 / ribosomal protein S28e
Unigene50970_All / 0.86 / 21.44 / 0.00 / ribosomal protein S28e
Unigene29371_All / 23.96 / 4.21 / 12.48 / ran-type small G protein
Unigene8353_All / 165.21 / 533.72 / 485.89 / calcium-binding protein
Unigene31550_All / 66.82 / 134.53 / 170.96 / probable calcium-binding protein CML27-like
Unigene7450_All / 13.06 / 3.75 / 13.62 / probable calcium-binding protein CML31
CL11305.Contig3_All / 18.32 / 55.32 / 56.58 / calmodulin-related protein isoform 4
CL15810.Contig2_All / 12.58 / 42.19 / 41.43 / calmodulin-related protein isoform 4
CL2190.Contig10_All / 0.1795 / 0.1318 / 0.0424 / eukaryotic initiation factor 4A
Proteolysis
Unigene10512_All / 8.25 / 3.72 / 4.62 / ubiquitin
Unigene952_All / 30.18 / 13.44 / 16.61 / ubiquitin
Unigene14006_All / 7.00 / 2.07 / 4.98 / proteasome component (PCI) domain protein
Unigene26883_All / 5.05 / 1.89 / 2.60 / 26S proteasome subunit P45
Unigene30058_All / 4.88 / 1.72 / 3.23 / 20S proteasome beta subunit, type 4
CL12798.Contig1_All / 5.91 / 2.08 / 3.07 / proteasome subunit beta type
Unigene29903_All / 14.00 / 7.45 / 6.50 / ubiquitin-protein ligase, putative
Unigene24730_All / 14.80 / 4.89 / 7.41 / ubiquitin-conjugating enzyme
Unigene21775_All / 6.21 / 1.69 / 7.06 / probable ubiquitin-conjugating enzyme E2
Unigene17203_All / 2.48 / 5.40 / 5.74 / E3 ubiquitin-protein ligase Os04g0590900-like
DNA processing
Unigene22054_All / 3.16 / 0.00 / 1.66 / DNA replication licensing factor MCM7, putative
Unigene36576_All / 3.64 / 0.47 / 1.20 / alkylated DNA repair protein alkB homolog 8
Unigene13401_All / 5.23 / 4.13 / 2.55 / DNA replication licensing factor MCM3-like protein
Unigene16330_All / 6.35 / 1.93 / 3.31 / DNA repair helicase XPB1-like
Unigene43204_All / 4.86 / 1.02 / 2.30 / ribonucleoside-diphosphate reductase
Unigene14000_All / 7.19 / 4.62 / 2.90 / cyclic nucleotide-gated ion channel 5-like,probable
Unigene13706_All / 7.07 / 3.59 / 2.04 / cyclic nucleotide-gated ion channel 4-like
Transcription factor
Unigene5325_All / 1.62 / 130.34 / 70.59 / AP2/ERF domain-containing transcription factor
Unigene7146_All / 110.35 / 39.64 / 48.63 / AP2/ERF transcription factor
Unigene26661_All / 4.53 / 9.42 / 12.19 / AP2/ERF domain-containing transcription factor
Unigene14020_All / 5.08 / 54.59 / 29.50 / WRKY transcription factor 22
Unigene1985_All / 10.11 / 113.12 / 87.48 / probable WRKY transcription factor 48
Unigene14870_All / 4.50 / 74.82 / 54.32 / probable WRKY transcription factor 48
Unigene23338_All / 13.84 / 60.80 / 43.44 / WRKY transcription factor 2
Unigene21429_All / 29.11 / 10.84 / 27.22 / WRKY transcription factor 1
Unigene422_All / 6.47 / 6.88 / 15.10 / WRKY transcription factor, putative
Unigene50055_All / 3.56 / 23.22 / 13.89 / putative MYB transcription factor
Unigene8269_All / 21.92 / 5.52 / 12.16 / r2r3-myb transcription factor, putative
Unigene12981_All / 18.04 / 1.27 / 2.46 / zinc finger protein, putative
Unigene29016_All / 12.52 / 1.42 / 2.22 / zinc finger protein 2-like
Unigene41061_All / 7.64 / 1.19 / 1.41 / zinc finger protein CONSTANS-LIKE 16
Unigene50638_All / 1.58 / 6.04 / 0.45 / zinc finger protein, putative
Unigene24815_All / 103.61 / 28.97 / 80.38 / leucine-rich repeat-containing protein, putative
Unigene13275_All / 9.30 / 4.14 / 4.30 / Leucine-rich repeat receptor protein kinase EXS precursor, putative
Unigene26736_All / 9.68 / 2.44 / 3.89 / Leucine-rich repeat receptor protein kinase EXS precursor, putative
Unigene5088_All / 51.55 / 29.94 / 69.26 / ethylene-responsive transcription factor 2-like
Unigene15074_All / 42.81 / 167.31 / 183.23 / ethylene-responsive transcription factor 4-like
Unigene18144_All / 5.64 / 13.24 / 14.94 / ethylene-responsive transcription factor ERF061-like
Unigene27265_All / 7.26 / 16.51 / 16.16 / ethylene-responsive transcription factor ERF012-like
Unigene31404_All / 1.69 / 26.47 / 28.27 / ethylene-responsive transcription factor CRF4
Unigene23825_All / 9.53 / 10.01 / 22.84 / ethylene-responsive transcription factor, putative

All genes in this list have a P-value for differential expression smaller than 10-5. FPKM (Fragments Per kb per Million fragments)

NE12: Normal embryos at 12 days after pollination; NE18: Normal embryos at 18 days after pollination; AE18: Abortive embryos at 18 days after pollination.

Table S5. Primer sequences for qRT-PCR

Unigene / Forward primer / Reverse primer
CL15915.Contig2_All caspase / ATACATCGGCTTTCACAGGC / ACAAAACGGCCTACCACTTG
CL8107.Contig2_All senescence-associated protein / TGGCACCTCTAGCCTCAAAT / GGGGACTCATGGAGAACAGA
CL5976.Contig2_All beta expansin 2 precursor / AAAGAGGAAAATAGCGACGAGTG / GCGACTAGAACCTGTTGGGAGTAT
Unigene37701_All cytoskeletal protein / TTCCCTACCCAGTCAGCGTG / ACGGGACAGGTTTGTTCACAG
Unigene34992_All plasma membrane H+ ATPase / CTTGCATCGTGGGAATTCTT / TGTGCCATTTTCCACTTTCA
Unigene13706_All cyclic nucleotide-gated ion channel 4-like / CACGGGCTTGTTTATTGACC / CACTCAAACTGCAGCCACAT
Unigene31648_All gibberellin 20-oxidase No3 / AATGGACAAAGTCGTGAGGC / AACTCGAGGAAAGCAGACCA
Unigene25739_All ethylene-responsive transciptional coactivator-like protein / ATGGGTGCAATGTCACAAGA / CTTCCTAGCGTAAACAGCGG
Unigene23825_All ethylene-responsive transcription factor, putative / GCCTATGCATTAAGGGGTCA / TCTTCCATTGTTTTCCCTCG
Unigene14006_All proteasome component (PCI) domain protein / GCTGAGGACTCCAGCATCAT / TTTGCCAGCGTTGTTTACTG
Unigene25222_All late embryogenesis abundant protein-like / TGACAACTGGTGGTATGGAAGG / TGACTGTTACTTTCGTCGTGGC
Unigene7903_All glutathione peroxidase / AACAAGCTCAACGGCAAAGT / AAACTGGTTGCATGGAAAGC
Unigene26736_All Leucine-rich repeat receptor protein kinase EXS precursor, putative / AAGTCATATCACTTTCAATACCAAACAC / CGAATTTGACGACAAGTCTAGCAG
Unigene23338_All WRKY transcription factor 2 / CGCAAGAAAACACGTTGAAA / AAATTATGGTTGCCGACGAG