Supplemental Figure Legends, Tables and Material and Methods

Supplemental figure legends, tables and material and methods

Figure S1:Effects of ISX and mock treatments on transcript levels of genes involved in starch metabolism (A) and photosynthesis (B). ISX treatment indicated by dashed and mock by solid lines. Y-axis indicates transcript levels expressed in Affymetrix units; X-axis shows time in hours. At3g61470 (LHCA2), At3g54890 (LHCA1), At5g54270 (LHCB3), At1g15820 (LHCB6), At2g39730 (RCA), At1g55490 (CPN60B), At4g20130 (PTAC14), At1g42970 (GAPB), At1g10760 (GWD1), At5g03650 (SBE2.2), At5g64860 (DPE1), At5g51820 (PGM), At5g48300 (ADG1), At1g03310 (ISA2), At3g29320 (PHS1), At1g11720 (SS3).

Figure S2: qRT-PCR based expression profiling of Arabidopsis seedlings treated with DCB for up to 18 h. Y-axis shows fold-change of ISX- vs mock-treated samples, X-axis shows time in hours. Values are the means and SEM are based on three biological replicates.

Figure S3:14C-sucrose based metabolic profiling of mock (blue) and ISX (red) treated seedlings after 8 h and 12 h of treatment. Shown are averages with error bars based on SD (n=3). * indicates statistical significant difference to mock-treated seedlings based on t-test p < 0.05.

Figure S4: Levels of soluble sugars (glucose, fructose, sucrose) and starch in mock (solid grey line) and DCB-treated (dashed black line) seedlings. X-axis shows time in hours and Y-axis shows levels of soluble sugars or starch in mmol C6 / g dry weight (dw). (A) Sucrose, (B) Fructose, (C) Glucose (D) Starch. Error bars are based on SD.

Figure S5: Evans blue Stain of Col-0 seedlings treated with different chemicals. The X-axis shows the different treatments performed. Seedlings were either treated for 10 h (mock, ISX, mock 10% PEG, ISX 10% PEG, 1 µM DCB, 2 µM DCB in blue) or 30 minutes (DMSO, 6.15 M NaCl; positive controls for cell death in red) before measurements were performed. Shown are means normalized to mock treatment ± SD (n=10 seedlings).

Figure S6: qRT-PCR-based expression analysis of genes involved in carbohydrate metabolism in Col-0 seedlings treated with different cellulose biosynthesis inhibitors and / or osmotica.

A Expression levels of genes in seedlings treated for 4 h with ISX / 300 mM sorbitol. B Expression levels of genes involved in carbohydrate metabolism after 8 h of DCB or DCB / 5% PEG treatment and after 4 h of 5% PEG alone in Col-0 seedlings. Values are the means and SEM from three biological replicates. * indicates statistical significant difference compared to the expression of the same gene in mock-treated samples. + indicates statistical significant difference of the expression of the same gene in 5% PEG / DCB- vs DCB-treated Col-0 seedlings.

Figure S7:A Effects of PEG treatments on soluble sugar levels and starch content in Col-0 seedlings. Data was normalized to the mock-treated Col-0 control. B Soluble sugar and starch contents of Col-0 seedlings ISX- (black), 300mM sorbitol (white) or ISX / 300 mM sorbitol (light-grey) treated for 10 h. C Soluble sugar and starch contents of Col-0 seedlings with DCB- (grey) or DCB / 5% PEG (white) for 10 h. Data in (B) and (C) was normalized to the 10 h mock-treated Col-0 control highlighted by black line. * indicate statistical significant differences compared to mock-treated seedlings. + indicate statistical significant differences compared to ISX (B) or DCB-treated (C) seedlings.

Supplemental tables and material & methods

Table S1.Starch and soluble sugar contents in Col-0 and mutant seedlings.Mean values (µmol C6/g dw) ± SD (n≥3) are shown after 0h and 10h of treatment with/ without isoxaben (iso)or DCB and/or 5% PEG. Data shown derive from one of at least 3 independent experiments.

Treatment / Starch / Glucose / Fructose / Sucrose
Col-0 / 0h / 310.77± 17.5 / 67.56± 9.5 / 71.22± 5.3 / 27.42± 17.5
10h mock / 308.64± 5.3 / 190.54± 9.0 / 95.34± 12.3 / 79.20± 5.3
10h iso / 455.95± 5.2 / 50.16± 5.0 / 36.30± 5.6 / 35.05± 5.2
aba2-1 / 0h / 297.16 ± 44.0 / 69.58 ± 6.1 / 66.91 ± 6.1 / 54.06 ± 2.7
10h mock / 266.54 ± 7.2 / 116.53 ± 2.8 / 76.89 ± 3.3 / 101.17 ± 5.3
10h iso / 384.17 ± 29.5 / 53.69 ± 1.4 / 46.19 ± 3.6 / 58.62 ± 1.4
kin10 / 0h / 474.75 ± 55.1 / 83.09 ± 6.7 / 66.88 ± 4.0 / 112.92 ± 5.0
10h mock / 524.01 ± 57.0 / 68.12 ± 2.9 / 46.24 ± 3.1 / 103.35 ± 5.5
10h iso / 719.29 ± 43.8 / 30.76 ± 0.8 / 23.36 ± 1.2 / 61.73 ± 1.2
kin11 / 0h / 314.23 ±16.7 / 70.78 ± 13.5 / 70.78 ±7.0 / 39.54 ± 4.8
10h mock / 413.19 ± 31.5 / 157.26 ± 4.9 / 99.33 ± 10.3 / 82.25 ± 8.3
10h iso / 587.3 ± 22.0 / 98.31 ± 13.0 / 59.68 ± 6.5 / 54.3 ± 8.7
ahk1 / 0h / 405.94 ± 38.3 / 65.65 ± 3.2 / 64.37 ± 3.5 / 56.04 ± 6.5
10h mock / 379.81 ± 11.7 / 109.92 ± 10.3 / 67.24 ± 6.5 / 95.09 ± 10.9
10h iso / 586.47 ± 15.3 / 48.55 ± 3.1 / 36.41 ± 2.6 / 53.28 ± 3.0
wak1 / 0h / 463.28 ± 36.5 / 68.95 ± 3.8 / 67.86 ± 4.45 / 64.06 ± 8.25
10h mock / 391.13 ± 40.7 / 109.21 ± 3.0 / 77.66 ± 2.0 / 117.47 ± 3.6
10h iso / 579.48 ± 22.3 / 48.42 ± 4.0 / 39.73 ± 3.5 / 64.9 ± 0.6
tmt1-2-3 / 0h / 657.32 ± 64.0 / 38.64 ± 1.6 / 30.32 ± 2.2 / 130.83 ± 12.2
10h mock / 751.27 ± 43.4 / 27.22 ± 3.4 / 22.39 ± 1.8 / 92.42 ±3.7
10h iso / 822.59 ± 15.2 / 26.98 ± 2.8 / 24.22 ± 2.3 / 62.46 ± 5.1
gin2-1 / 0h / 325.36 ± 22.9 / 161.38 ± 12.4 / 101.72 ± 6.9 / 57.56 ± 6.2
10h mock / 473.53 ± 21.0 / 260.38 ± 25.3 / 120.47 ± 12.1 / 108.55 ± 10.3
10h iso / 609.4 ± 22.3 / 193.48 ± 16.1 / 64.99 ± 9.6 / 60.50 ± 45.0
cre1 / 0h / 494.61 ± 60.2 / 80.4 ± 3.4 / 80.61 ± 4.6 / 99.77 ± 8.8
10h mock / 579.02 ± 31.1 / 64.88 ± 6.9 / 62.78 ± 3.9 / 117.59 ± 3.8
10h iso / 712.64 ± 39.0 / 43.15 ± 2.5 / 38.25 ± 5.9 / 91.92 ± 4.9
cre1 + / 0h / 519.35 ± 34.9 / 86 ± 6.5 / 80.17 ± 9.2 / 109.29 ± 13.8
PEG / 10h mock / 537.67 ± 21.5 / 65.69 ± 6.5 / 43.05 ± 5.7 / 117.44 ± 10.2
10h iso / 609.39 ± 26.8 / 36.41 ± 10.2 / 33 ± 1.7 / 93.24 ±4.5
mca1 / 0h / 309.47 ± 14.3 / 56.13 ± 2.7 / 54.6 ± 2.3 / 25.67 ± 1.0
10h mock / 348.45 ± 4.5 / 75.28 ± 2.6 / 38.81 ± 3.6 / 100.9 ± 4.0
10h iso / 434.68 ± 23.7 / 36.27 ± 1.8 / 28.35 ± 1.8 / 59.85 ± 2.6
mca1 + / 0h / 244.83 ± 34.7 / 73.08 ± 7.0 / 72.1 ± 12.9 / 38.72 ± 15.3
PEG / 10h mock / 231.83 ± 6.5 / 62.21 ± 8.4 / 45.92 ± 2.8 / 90.28 ± 3.1
10h iso / 302.9 ± 1.7 / 29.48 ± 10.0 / 26.93 ± 3.3 / 69.37 ± 3.9
rbohDF / 0h / 186.56 ± 15.1 / 61.2 ± 3.6 / 65.99 ± 1.1 / 11.23 ± 1.0
10h mock / 241.7 ± 11.3 / 167.21 ± 8.4 / 107.03 ± 10.4 / 95.11 ± 10.6
10h iso / 341.68 ± 26.4 / 70.35 ± 4.0 / 50.97 ± 2.2 / 66.61 ± 7.8
rbohDF+ / 0h / 220.26 ± 18.4 / 70.17 ± 4.6 / 75.14 ± 5.2 / 10.62 ± 1.0
PEG / 10h mock / 223.75 ± 16.8 / 127.88 ± 4.0 / 76.97 ± 1.8 / 85.73 ± 3.7
10h iso / 305.25 ± 12.1 / 66.14 ± 2.3 / 46.18 ± 4.1 / 54.54 ± 2.1
ixr1-1 / 0h / 377.83 ± 24.4 / 72.03 ± 2.8 / 61.8 ± 4.4 / 87.49 ± 6.0
10h mock / 437.14 ± 6.6 / 43.65 ± 6.6 / 32.33 ± 3.8 / 73.33 ± 11.2
10h iso / 462.01 ± 19.4 / 48.33 ± 2.2 / 34.71 ± 1.7 / 82.27 ± 2.2
ixr1-1 + / 0h / 379.01 ± 21.6 / 61.06 ± 4.4 / 52.83 ± 4.0 / 69.34 ± 4.2
PEG / 10h mock / 518.83 ± 10.3 / 40.36 ± 1.4 / 22.13 ± 2.9 / 82.97 ± 1.2
10h iso / 465.31 ± 26.8 / 38.19 ± 2.4 / 23.83 ± 4.2 / 75.20 ± 8.0
Col-0 / 0h / 148.97 ± 12.5 / 86.43 ± 2.9 / 61.5 ± 19.2 / 53.96 ± 4.7
10h mock / 204.45 ± 18.1 / 80.24 ± 5.7 / 32.66 ± 2.5 / 91.91 ± 5.5
10h DCB / 237.72 ± 12.0 / 65.54 ± 8.5 / 21.87 ± 3.4 / 60.35 ± 9.2
10h DCB + 5% PEG / 169.59 ± 26.2 / 90.94 ± 13.1 / 29.56 ± 1.6 / 76.03 ± 8.7

Table S2.Effects of treatment with osmotica on carbohydrate distribution inCol-0 seedlings. Mean values (µmol C6/g dw) ± SD (n≥3) of glucose, fructose, sucrose and starch contents are shown after 0h and 10h of treatment with and withoutisoxaben (iso)and in combination with 2.5%, 5%, 10% PEG (P), 300mM sorbitol (SOR), 300mMmannitol (MAN), 150mM potassium chloride(KCl) and 150mM sodium chloride (NaCl). Data shown derive from one of at least 3 independent experiments.

Treatment / Starch / Glucose / Fructose / Sucrose
10h / 473.60 ± 33.79 / 76.73 ±5.56 / 38.30 ± 4.91 / 91.51 ± 14.54
10h iso / 783.47 ± 54.71 / 26.30 ±3.61 / 9.54 ± 2.23 / 65.16 ± 6.81
2.5%P 10h / 634.93 ± 38.22 / 48.44 ± 4.18 / 34.0 ± 11.93 / 77.52 ± 7.07
2.5%P 10h iso / 686.10 ± 77.36 / 35.47 ± 6.51 / 21.94 ± 4.05 / 50.2 ± 3.85
5%P 10h / 488.94 ± 28.72 / 77.12 ±3.14 / 42.24 ± 2.18 / 106.68 ±3.65
5%P 10h iso / 586.92 ± 32.04 / 43.00 ±0.92 / 24.93 ± 1.04 / 72.21 ± 2.33
10%P 10h / 548.95 ± 33.19 / 41.68 ±3.02 / 29.11 ± 2.49 / 54.99 ± 8.98
10%P 10h iso / 533.11 ± 111.85 / 33.73 ± 4.90 / 15.24 ± 0.78 / 42.47 ± 5.37
SOR 10h / 409.3 ± 56.27 / 139.83 ± 6.3 / 82.85 ± 5.62 / 55.26 ± 3.02
SOR 10h iso / 415.56 ± 7.1 / 137.38 ±4.82 / 74.02 ±4.8 / 44.02 ± 3.23
MAN 10h / 407.17 ± 37.65 / 132.86 ± 8.4 / 65.29 ± 6.36 / 50.15 ± 3.81
MAN 10h iso / 466.37 ± 29.37 / 112.95 ± 3.5 / 65.13 ± 1.51 / 51.86 ± 1.95
KCl 10h / 397.33± 13.62 / 58.02± 3.56 / 36.81± 2.12 / 112.77± 7.3
NaCl 10h / 398.16± 10.57 / 65.53± 1.79 / 42.07± 2.25 / 113.57± 5.76

Table S3.Rubiscoactivase levels in Col-0 seedlings after different treatments based on ELISA results. Absolute values at OD450 providing an indication of the activase levels are shown in the table below.

Col-0 / Col-0 5% PEG
0h Mock / 0.47 ± 0.05 / 0.96 ± 0.14
0h ISX / 0.41 ± 0.03 / 0.98 ± 0.05
0h DCB / 0.53 ± 0.04 / 0.45 ±0.04
10h Mock / 0.44 ± 0.02 / 0.88 ± 0.14
10h ISX / 0.26 ± 0.02 / 0.61 ± 0.10
10h DCB / 0.53 ± 0.04 / 0.34 ± 0.05
ixr1-1 / WT control
Mock / 0.47 ± 0.04 / 0.57 ± 0.05
ISX / 0.49 ± 0.04 / 0.43 ± 0.01

Supplemental Materials and Methods

Microarray data

The Affymetrix microarray based time course experiment performed by (Hamann et al., 2009) suggested down-regulation of the following genes involved in photosynthesis and starch metabolism:

At3g61470 (LHCA2), At3g54890 (LHCA1), At5g54270 (LHCB3), At1g15820 (LHCB6),At2g39730 (RCA), At1g55490 (CPN60B), At4g20130 (PTAC14), At1g42970 (GAPB), At1g10760 (GWD1), At3g46970 (PHS2), At5g64860 (DPE1), At2g40840 (DPE2), At2g39930 (ISA1), At1g03310 (ISA2), At3g29320 (PHS1), At5g03650 (SBE2.2).

Gene specific primers used for qRT-PCR experiments

At5g54270 (for: gaattccctggcgattatgg; rev: acttcaggggttatgcaacc),

At1g55490 (for: cctgttttgatcaccagagg; rev: cctgttttgatcaccagagg),

At1g42970 (for: actctttccctgctcaatgc; rev: ggagttgatgttgtcacagc),

At1g03310 (for: actccaaagagggaagatcc; rev: tttggctcatttggctcagc),

At5g64860 (for: cacttcagaggatttgcagg; rev: atcttcccaacgcctttgg),

At1g10760 (for: aagttctgacatgccatgg; rev: tctcgttccatttcgaagc),

At4g05320(for: accctaacgggaaagacgat; rev: gagttctgccatcctccaac).

Evans blue staining

To determine if isoxaben or PEG treatment causes lethality, Evans Blue staining adapted from (Sanevas et al. 2007) was performed. For positive controls seedlings were treated for 1h with 100%DMSO, 100% EtOH or a saturated sodium chloride solution (6M). After 12h of treatment, ten biological replicates (per treatment to be tested) consisting of 20 individual seedlings were treated with 0.25% (w/v) Evans Blue for 15minutes. The seedlings were washed with sterile milli-Q water until excess dye was removed. Each biological replicate was incubated for 24h in 1ml of N,N-dimethylformamide. The formamide was transferred to a cuvette and the absorption at 600nm was measured. Average and standard deviation were determined for 10 biological replicates per treatment.