RNA Interference (Sirna, Shrna)

Title: RNA interference (siRNA, shRNA)

Daphne S. Cabianca1, 3 and Davide Gabellini1, 2

1Division of Regenerative Medicine, San Raffaele Scientific Institute, Milan, Italy.

2Dulbecco Telethon Institute, Milan, Italy.

3Università Vita-Salute San Raffaele, Milan, Italy

* Address correspondence to: Davide Gabellini, Division of Regenerative Medicine, San Raffaele Scientific Institute, DIBIT1 2A3 room 49A, via Olgettina 58, 20132 Milan, Italy; e-mail:

1. Abstract

The discovery that gene expression can be regulated using small RNAs complimentary to messenger RNAs — a process known as RNA interference (RNAi) — has markedly advanced our understanding of eukaryotic gene regulation and function. Notably, just one decade from its discovery, RNAi is already being tested in clinical trials and is set to revolutionize the treatment of disease.

In the recent years, several progresses have been made that improved the efficiency and widened the possibilities of RNAi. Lentiviral-mediated delivery of RNAi represents a major advance in the field. Despite transfection of chemically synthesized small RNAs, lentiviral-mediated gene silencing can be applied not only to regular cell lines, but also to primary or non-dividing cells. Furthermore, the transduced vectors can contain markers for selection, allowing for the generation of stable cell lines, and cassettes to obtain a regulated shRNA expression.

The protocol contained in this chapter describes the steps leading to the production of lentiviral vectors and to the infection of the desired recipient cells.

Keywords: RNAi, shRNA, siRNA, lentiviruses

2. Theoretical background

2.1 RNAi

About ten years ago Fire and Mello showed that introducing a long double-stranded RNA (dsRNA) into C. elegans could significantly reduce the expression of homologous endogenous genes [1]. This milestone study lead to the discovery of RNAi (RNA interference), an evolutionary conserved gene silencing mechanism based on small dsRNA molecules.

Later, Tuschl and co-workers modified the technique developed in worms, opening the way to the use of RNAi in mammalian cells [2]. In particular, they showed that the RNAi cascade is induced by RNAs approximately 21 nucleotides long, and that chemically synthesized 21mer RNAs, named short interfering RNAs (siRNAs), can trigger RNAi [3].

Due to its high specificity and efficiency, RNAi has developed into an extremely powerful tool in molecular biology.

The effector RNA molecules of RNAi are complexed with the protein components of the RNA-induced silencing complex (RISC). The small RNAs can silence gene expression by two mechanisms: post-transcriptional gene silencing (PTGS), and transcriptional gene silencing (TGS). PTGS can, in turn, be divided into two main mechanisms: direct sequence-specific cleavage, and translational repression and RNA degradation. Direct sequence-specific cleavage occurs when the targeted mRNA is perfectly complementary to the siRNA. Upon loading of the siRNA onto the RISC, the sense strand is removed from the RNA duplex. Next, the remaining antisense strand guides RISC to the complementary target RNA, leading to its cleavage and degradation (Fig 1).

2.2 siRNAs and shRNAs

Traditionally, siRNAs are considered as “exogenous agents”, but there are increasing evidences of endogenous siRNAs produced in plants, fungi and animals [4, 5, 6, 7, 8, 9, 10, 11]. A major class of these molecules derive from transposable elements, consistent with the fact that RNAi functions to silence transposon expression and propagation [12]. Furthermore, heterochromatic regions of the genome including centromeres and telomeres contain repetitive elements that encode for siRNAs [5, 6]. Importantly, production of these RNAs and the RNAi machinery are required to establish a heterochromatic conformation at centromeres [13, 14].

Beside its fundamental role as PTGS mechanism, RNAi can also act at the transcriptional level, as it can induce transcriptional gene silencing by directing DNA methylation in plants [15, 16]. Furthermore, it was recently shown that dsRNAs can activate gene transcription when targeted to promoters, a phenomenon also known as RNAa (RNA activation) [17]. Finally, it was recently reported that siRNAs targeting intronic or exonic sequences close to an alternative exon regulate its splicing [18].

In mammalian cells, due to degradation and their progressive dilution as the cells divide, the effect of chemically synthesized siRNA introduced by transfection is transient and generally lasts only a few days. To overcome this limit, alternative, vector-based strategies for the delivery of RNAi, have been developed [19]. Vectors containing short hairpin RNAs (shRNAs), where the sense and antisense sequences are connected by a loop and transcribed as a single RNA molecule, are an efficient alternative. Upon transcription, the RNA rapidly forms a hairpin structure with a loop that is cleaved by the cellular endoribonuclease Dicer into siRNA, which is then bound to RISC [20] (Fig 1).The great advantage of this strategy is that shRNAs can be continuously synthesized by the host cell, making RNAi much more durable. Notably, vector-based systems allow the generation of stably transfected cell lines using drug resistance markers [21] and the production of shRNAs can be regulated or induced [21, 22]. Moreover, since shRNAs require cleavage by Dicer and are assimilated into the endogenous miRNA pathway (see Chapter by Zavolan for details) they display increased efficiency compared to chemically synthesized siRNA [20].

Fig 1 Schematic representation of siRNA- and shRNA-induced RNAi. Hairpin type vectors can be introduced in the cells by transfection or viral-mediated transduction. Inside the cells, the hairpin is transcribed and processed by Dicer to generate siRNAs. SiRNA oligos are directly transfected in the cells. (Adapted from [23]).

Plasmid vectors can be very difficult to deliver in primary cells and can display low transfection efficiency with some cell lines [24]. These limitations lead to the development of viral-mediated systems for shRNA delivery [25, 26, 27]. For example, using lentiviral or adeno-associated viral systems is possible to efficiently transfer shRNas to a broad range of mammalian cells including primary cells. Furthermore, due to their ability to infect both dividing and non-dividing cells, lentiviral vectors can be used with terminally differentiated cells such as neurons or with live animals [28].

2.3 Lentiviral-mediated RNAi

Lentiviruses, as all retroviruses, have an RNA genome which is retro-transcribed into dsDNA that is integrated in the host genome [29]. There are several advantages in using lentiviral-mediated gene transfer, such as permanent expression of the target gene and high transduction efficiency of mammalian cells, both quiescent [28] and proliferating, and of primary cells [30].

Since they derive form HIV, viruses must be modified to produce safe vectors for gene delivery. Tipically, essential components required for virus replication are removed from the engineered vector and are substituted by the shRNA sequence [31].

For this reason, lentiviral particles must be assembled using so-called “packaging cells” (usually HEK 293 cells) and require the presence of an envelope and a packaging plasmid [31]. The final result is a lentiviral particle capable of infecting the cells, but deprived of the possibility to replicate itself.

3. Protocol:

3.1 Map of pLKO.1 puro

Fig 2: Map of pLKO.1 containing an shRNA insert. The original pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by digestion with AgeI and EcoRI (see later).

Table 1. Description of pLKO.1-TRC cloning vector elements.

Description / Vector Element
U6 / Human U6 promoter drives RNA Polymerase III transcription for generation of shRNA transcripts.
cPPT / Central polypurine tract, cPPT, improves transduction efficiency by facilitating nuclear import of the vector's preintegration complex in the transduced cells.
hPGK / Human phosphoglycerate kinase promoter drives expression of puromycin.
Puro R / Puromycin resistance gene for selection of pLKO.1 plasmid in mammalian cells.
sin 3'LTR / 3' Self-inactivating long terminal repeat.
f1 ori / f1 bacterial origin of replication.
Amp R / Ampicillin resistance gene for selection of pLKO.1 plasmid in bacterial cells
pUC ori / pUC bacterial origin of replication.
5'LTR / 5' long terminal repeat.
RRE / Rev response element.

3.2 Oligos design

Determining the Optimal 21-mer Targets in your Gene

The design of optimal shRNAs follows the same general rules used for siRNAs.

General guidelines are summarized below (modified from Protocol Online).

1.siRNA targeted sequence is usually 21 nt in length.

2.Avoid regions within 50-100 bp of the start codon and the termination codon.

3.Avoid intron regions.

4.Avoid stretches of 4 or more bases such as AAAA, CCCC.

5.Avoid regions with GC content <30% or > 60%.

6.Avoid repeats and low complex sequence.

7.Avoid single nucleotide polymorphism (SNP) sites.

8.Perform BLAST homology search to avoid off-target effects on other genes or sequences.

Listed below there are some helpful website to design effective siRNAs and shRNAs:

Recently, several companies developed validated siRNA and shRNA libraries to specifically knock down thousands of human and mouse genes. Thus, it is possible to buy ready-to-use siRNAs or vectors for RNAi.

Some of these companies are listed below:

• Dharmacon
• The RNAi Consortium
• Qiagen
• Ambion
• RNAx
• GeneCopoeia

Ordering Oligos Compatible with pLKO.1

Each final shRNA construct requires the designing of two complementary oligos containing a sense (in red) and an antisense (in green) sequence, where the first one is identical to the target gene mRNA. Once annealed, the dsDNA molecule obtained will have at the 5’ a sticky end compatible with an AgeI digested site, while at the 3’ the end will be suitable for ligation with an EcoRI-digested site. The sense and antisense sequences are connected by a spacer capable of forming a loop (Fig 3).

Fig 3. Schematic representation of the complementary oligos to be designed. Red: sense sequence; green: antisense sequence.

3.3 Generating the pLKO.1 puro with shRNA construct

Annealing of the oligos

1. Resuspend oligos in ddH2O to a concentration of 1 μg/μl, then mix:

5 μL Forward oligo

5 μL Reverse Oligo

5 μL 10x NEB buffer 2 (New England Biolabs Restriction Endonuclease Reaction Buffer 2)

35 μL ddH2O

2. Incubate 4 minutes at 95oC.

3. Incubate the sample 10 minutes in a beaker containing ddH2O at 70oC, then let it slowly cool down to room temperature. This will take a few hours, but it is important for the cooling to occur slowly in order for the oligos to anneal.

Preparation of pLKO.1 TRC for cloning

1. Digest pLKO.1 TRC-cloning vector with AgeI and EcoRI.

2. Purify the 7 kb band by gel extraction, quantify the DNA and proceed to ligation.

Ligating and Transforming into Bacteria

1. Use your ligation method of choice. Ligate 50 ng of digested pLKO.1 TRC-cloning vector with 200 ng of annealed oligos from the previous steps.

2. Incubate at 16oC over night.

3. Transform 1-2 μL of ligation mix with your usual transformation protocol. Plate on LB agar plates containing 100 μg/mL ampicillin.

Screening for Inserts

You may screen for plasmids that were successfully ligated by PCR using the primer shown below (Table 2). However, once you have identified the positive clones, it is important to verify the insert by conducting a sequencing reaction (for the sequencing reaction you can use the same primers used for PCR).

Table 2. Sequence of the primers used for screening clones by PCR.

oligo / sequence
LKO 5’ / tggactatcatatgcttaccgtaac
LKO 3’ / gtatgtctgttgctattatgtcta

The thermal cycling profile of this PCR reaction is the following:

3’ at 95° C

30’’ at 95° C

30’’ at 60° C

30’’ at 72° C

5’ at 72° C

Follow the manufacturer’s instruction of the Taq polymerase of your choice for optimal magnesium and oligos concentration.

A cartoon of the shRNA insert cloned inside pLKO.1 puro is shown in Figure 4.

Fig 4. Detail of the shRNA insert. The U6 promoter directs RNA Polymerase III transcription of the shRNA. The shRNA contains 21 "sense" bases that are identical to the target gene, a loop and 21 "antisense" bases that are complementary to the "sense" bases. The shRNA is followed by a polyT termination sequence for RNA Polymerase III.

3.4 Production of lentiviral particles

1. Seed HEK 293T cells at 1.3-1.5x105 cells/ml (6 ml per plate)in low antibiotic growth medium (DMEM + 10% FBS + 0.1x Pen/Strep) in 6 cm tissue culture plates.

1. Incubate cells for 24 hours (37 °C, 5% CO2), or until the following afternoon. At this point the cells should be around 70% confluent.

1. Transfect the cells following your transfection reagent’s instructions and using these quantities of DNA (considering a 6 cm plate, scale up or down the quantities accordingly if you use a different growing area):

Packaging plasmid (pCMV-dR8.91)900 ng

Envelope (VSV-G/pMD2G)100 ng

Hairpin-pLKO.1 vector1 μg

1. Incubate cells for 18 hours (37 °C, 5% CO2), or until the following morning.

1. Change the media with high serum growth medium (DMEM + 30% FBS + 1x Pen/Strep).

1. Incubate cells for 24 hours (37 °C, 5% CO2).

1. Harvest the medium containing the lentiviral particles (~40 hours post transfection). Filter the media using a 0.22 um filter unit, place it in a falcon tube and store it at 4 °C for hours or days (or -20 °C or -80 °C for long term storage). Replace the medium with high serum growth medium (DMEM + 30% FBS + 1x Pen/Strep).

1. After 24 hours repeat the viral harvesting.

1. Pool the virus-containing media as desired.

3.4 Lentiviral Infection

Lentiviral infections should be optimized for each cell line and cell-based assay. For example, the following parameters should be tested before starting infections to determine the optimal conditions for a given experiment:

- cell seeding density

- amount of lentivirus

- puromycin concentration

- timecourse

1. Seed cells at appropriate density in 5 ml media in 6 cm plates.

a. Adherent cells: seed 1 day prior to infection. Incubate overnight (37 °C, 5% CO2).

b. Suspension cells: seed at the day of infection in media containing polybrene (final concentration is 8 μg/ml).

2. Add virus to cells:

a. (Adherent cells) Remove growth media and add fresh media containing polybrene (final concentration is 8 μg/ml). Alternatively, remove a portion of the growth media and supplement with media containing polybrene. Adjust volumes and polybrene concentration to achieve the correct final polybrene concentration. Add the collected virus to the cells.

Note: Protamine sulfate may be substituted if polybrene is toxic to cells.

b. Add virus to cells.

3. Incubate cells overnight (37 °C, 5% CO2).

Note: If polybrene or protamine sulfate brings toxicity to cells, then remove media and replace with fresh growth media at infection day.

4. Change media at 24 hours post-infection. Remove media and replace with 5 ml fresh growth media. If puromycin selection is desired, use fresh growth media containing puromycin.

Note: Puromycin concentration should be optimized for each cell line; typical concentrations range from 2-5 μg/ml.

5. Incubate cells (37 °C, 5% CO2), replacing growth media (with puromycin, if desired) as needed every few days. Incubation periods are highly dependent on the post-infection assay. Puromycin selection requires at least 48 hours. The following recommendations are general guidelines only, and should be optimized for a given cell line and assay.

6. Assay infected cells.

Table 3 Timecourse of post-infection assays.

Post-infection assay / Incubation time post-infection / Incubation time with puromycin selection
mRNA knockdown (qPCR) / 3+ days / 2+ days
Protein knockdown (Western) / 4+ days / 3+ days
Phenotypic assay / 4+ days / 3+ days

4. Example of an experiment

The transcriptional regulator YY1 was targeted by RNAi using a lentiviral-mediated shRNA delivery. Cells containing shRNAs against luciferase were generated as control. Figure 5-A shows a typical RT-qPCR analysis showing specific reduction of YY1 mRNA levels upon using YY1 shRNAs. The samples were normalized to the housekeeping gene GAPDH.

Figure 5-B shows result of immunoblotting assay indicating that YY1 knock down is occurring also at the protein level.

Fig 5. Lentiviral-mediated shRNA delivery to knock down the expression of the transcriptional regulator YY1. A) RT-gPCR showing the mRNA levels of YY1. B) Immunoblot assay to show the down-regulation of YY1 protein.

5. Troubleshooting

Problem / Reason / Solution
Most of the clones in the construction of the pLKO.1 puro with shRNA does not contain the annealed oligos insert. / The digested vector rearranges and circularizes, thus becoming highly favourite during bacteria transformation. / De-phosphorylate the digested vector and phosphorylate the oligos.
Few or no transduction. /

1. No or low virus is made (p24 assay in the supernatant is absent or low).

1. The virus is made (high p24 in the supernatant).

/ Check packaging plasmid; DNA quality; transfection efficiency; solution quality; cell quality.
Perform a transduction test with a GFP reporter.
If negative: check envelope plasmid.
If no transduction with a correct envelope plasmid: check the vector plasmid.
If positive: check for HIV sequences in target cells genome.
If HIV sequences ARE NOT present, re-clone the vector (possible defects in packaging of genomic RNA, reverse transcription or integration).
If HIV sequences ARE present check length of integrant (possible splicing of promoter, of shRNA,..).
No gene knock down detection. / The shRNAs were uneffective. / Design new shRNAs.

References

[1] Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806-811.

[2] Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-498.

[3] Elbashir, S.M., Lendeckel, W., and Tuschl, T. (2001). RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15, 188-200.

[4] Ambros, V., Lee, R.C., Lavanway, A., Williams, P.T., and Jewell, D. (2003). MicroRNAs and other tiny endogenous RNAs in C. elegans. Curr. Biol. 13, 807-818.

[5] Aravin, A.A., Lagos-Quintana, M., Yalcin, A., Zavolan, M., Marks, D., Snyder, B., Gaasterland, T., Meyer, J., and Tuschl, T. (2003). The small RNA profile during Drosophila melanogaster development. Dev. Cell. 5, 337-350.

[6] Xie, Z., Johansen, L.K., Gustafson, A.M., Kasschau, K.D., Lellis, A.D., Zilberman, D., Jacobsen, S.E., and Carrington, J.C. (2004). Genetic and functional diversification of small RNA pathways in plants. PLoS Biol. 2, E104.

[7] Ghildiyal, M., Seitz, H., Horwich, M.D., Li, C., Du, T., Lee, S., Xu, J., Kittler, E.L., Zapp, M.L., Weng, Z., and Zamore, P.D. (2008). Endogenous siRNAs derived from transposons and mRNAs in Drosophila somatic cells. Science 320, 1077-1081.

[8] Watanabe, T., Totoki, Y., Toyoda, A., Kaneda, M., Kuramochi-Miyagawa, S., Obata, Y., Chiba, H., Kohara, Y., Kono, T., Nakano, T. et al. (2008). Endogenous siRNAs from naturally formed dsRNAs regulate transcripts in mouse oocytes. Nature 453, 539-543.