Electronic Supplementary Material 1. FITO SSR name, B.oleracea clone used to mined SSR motif (NCBI clone accession number), repeat type, motif repeat type and primary A. thaliana Chromosome homology and other relevant information for 587 primers pairs developed using B. oleracea sequence information
SSR Name / NCBI clone accession No. / Repeat type / Motif repeat type / Primary Arabidopsis thaliana chromosome homology and other relevant informationFITO001 / A18812 / trinucleotide / CTCCTCCTCCTCC / No information available at this timermation available at this time
FITO002 / A18814 / trinucleotide / TAATAATAATAA / No information available at this timermation available at this time
FITO003 / BH006976 / tetranucleotide / TTCTTTCTTTCTTTCTTTG / No information available at this timermation available at this time
FITO004 / BH006978 / pentanucleotide / CCCCTCCCCT / No information available at this timermation available at this time
FITO005 / AB000970 / dinucleotide / GAGAGTAATAAAGAGAGAGAAAAAAAGATGAGA / No information available at this timermation available at this time
FITO006 / BH006991 / dinucleotide / AATGGGAAACAAATAATAAT / No information available at this timermation available at this time
FITO007.1 / BH006992 / dinucleotide / TCTCTCTCTCTCTCTCT / No information available at this timermation available at this time
FITO007.2 / BH006992 / dinucleotide / TCTCTCTCTCTCTCTCT / No information available at this timermation available at this time
FITO008 / BH006998 / dinucleotide / CTCTCTCT / No information available at this timermation available at this time
FITO009 / BH007000 / trinucleotide / TTTTTATTATTATTTTTATTTTATTTTA / No information available at this timermation available at this time
FITO010 / BH007006 / dinucleotide / TATATATATATA / No information available at this timermation available at this time
FITO011 / BH007000 / pentanucleotide / TTTTATTTTA / Primary Arabidopsis homology: Chromosome 3 [14518683-14518910] Minus strand
FITO012 / BH007003 / dinucleotide / ATATATATATAAATATAT / No information available at this timermation available at this time
FITO013 / BH007003 / dinucleotide / TATATATATATATATATA / No information available at this timermation available at this time
FITO014 / BH007006 / dinucleotide / TATATATATATA / No information available at this timermation available at this time
FITO015 / BH007008 / dinucleotide / ATATATATATATATATATAT / No information available at this timermation available at this time
FITO016 / BH007009 / dinucleotide / ATATATATATATATATAT / No information available at this timermation available at this time
FITO017 / BH007009 / dinucleotide / TATATATATATATATATATATATATATA / No information available at this timermation available at this time
FITO018 / A62402 / trinucleotide / ACGACGACGACG / Sequence 1 from Patent WO9713865
FITO019 / BH007039 / dinucleotide / TATATATATATATATA / No information available at this timermation available at this time
FITO020 / A18812 / trinucleotide / CTCCTCCTCCTC / No information available at this timermation available at this time
FITO021 / A18812 / trinucleotide / CTCCTCCTCCTC / No information available at this timermation available at this time
FITO022 / A43577 / dinucleotide / AGAGAGAGAG / Sequence 2 from Patent WO9507357
FITO023 / A43577 / dinucleotide / TCTCTCTCTC / Sequence 2 from Patent WO9507357
FITO024 / A43577 / pentanucleotide / TTTTCTTTTCTTTTC / Sequence 2 from Patent WO9507357
FITO025 / A43577 / trinucleotide / TCTTCTTCTTCT / Sequence 2 from Patent WO9507357
FITO026 / BH007091 / dinucleotide / TATATATATA / No information available at this timermation available at this time
FITO027 / BH007092 / dinucleotide / TATATATATA / No information available at this timermation available at this time
FITO028 / BH007093 / dinucleotide / ATATATATATATAT / Primary Arabidopsis homology: Chromosome 3 [3807505-3807548] Plus strand
FITO029 / BH007094 / dinucleotide / ATATATATATATAT / Primary Arabidopsis homology: Chromosome 3 [5964142-5964270] Plus strand
FITO030 / BH007228 / dinucleotide / TTTTTTTTTTTTTT / Primary Arabidopsis homology: Chromosome 1 [17329642-17329731] Plus strand
FITO031 / BH007230 / dinucleotide / (TA)23 / Primary Arabidopsis homology: Chromosome 1 [23564932-23565062] Plus strand
FITO032 / A62529 / trinucleotide / AACAACAACAACAACAAC / Sequence 34 from Patent WO9716559
FITO033 / A62529 / trinucleotide / ATTATTATTATT / Sequence 34 from Patent WO9716559
FITO034 / BH007122 / dinucletide / (GA)39 / No information available at this timermation available at this time
FITO035 / AB000971 / dinucleotide / AGAGAGAGAGAG / No information available at this timermation available at this time
FITO036 / AB024415 / pentanucleotide / TGGAATGGAA / No information available at this timermation available at this time
FITO037 / BH007arbi / trinucleotide / G(TGG)19 / No information available at this timermation available at this time
FITO038 / AB032260 / trinucleotide / TCGTCGTCGTCGTCG / Brassica rapa Bra r 1 gene for pollen calcium-binding protein, complete cds
FITO039 / AB032260 / trinucleotide / ATCATCATCATCATC / Brassica rapa Bra r 1 gene for pollen calcium-binding protein, complete cds
FITO040 / AB032260 / pentanucleotide / TTTTGTTTTGTTTTGTTTTG / Brassica rapa Bra r 1 gene for pollen calcium-binding protein, complete cds
FITO041 / BH007335 / tetranucleotide / TTTATTTATTTA / No information available at this timermation available at this time
FITO042 / BH007339 / trinucleotide / AACAACAACAAC / No information available at this timermation available at this time
FITO043 / AB000971 / dinucleotide / AGAGAGAGAGAG / No information available at this timermation available at this time
FITO044 / BH007360 / dinucleotide / CTCTCTCTCTCTCTCT / No information available at this timermation available at this time
FITO045 / AF453322 / trinucleotide / TCCTCCTCCTCCTCCTCCTCC / No information available at this timermation available at this time
FITO046 / BH007371 / trinucleotide / AAGAAGAAGAAG / Primary Arabidopsis homology: Chromosome 3 [22376229-22376392] Plus strand
FITO047 / AF016009 / trinucleotide / ACAACAACAACA / No information available at this timermation available at this time
FITO048 / AF016009 / trinucleotide / AGAAGAAGAAGA / No information available at this timermation available at this time
FITO049 / AF016010 / trinucleotide / ACAACAACAACAACA / No information available at this timermation available at this time
FITO050 / AF016010 / trinucleotide / AGAAGAAGAAGA / No information available at this timermation available at this time
FITO051 / AF016011 / trinucleotide / ACAACAACAACAACA / No information available at this timermation available at this time
FITO052 / AF016011 / trinucleotide / AGAAGAAGAAGA / No information available at this timermation available at this time
FITO053 / AY280868 / dinucleotide / TCTCTCTCTC / Brassica napus putative beta-glucan elicitor receptor (Bger1), constans-like protein (CoL)
FITO054 / AY280868 / trinucleotide / AAGAAGAAGAAG / Brassica napus putative beta-glucan elicitor receptor (Bger1), constans-like protein (CoL)
FITO055 / AY280868 / trinucleotide / ACAACAACAATAACAACAACAACA / Brassica napus putative beta-glucan elicitor receptor (Bger1), constans-like protein (CoL)
FITO056 / AY280868 / trinucleotide / AGAAGAAGAAGA / Brassica napus putative beta-glucan elicitor receptor (Bger1), constans-like protein (CoL)
FITO057 / AY280868 / trinucleotide / ACAACAACAACA / Brassica napus putative beta-glucan elicitor receptor (Bger1), constans-like protein (CoL)
FITO058 / AY280868 / trinucleotide / AGAAGAAGAAGA / Brassica napus putative beta-glucan elicitor receptor (Bger1), constans-like protein (CoL)
FITO59 / BH007396 / dinucleotide / GAGAGAGAGAGA / No information available at this timermation available at this timermation available
FITO60 / BH007405 / dinucleotide / TGTGTGTGTGTG / Primary Arabidopsis homology: Chromosome 5 [699879-699944] Plus strand
FITO61 / BH007406 / trinucleotide / GAAGAAGAAGAA / Primary Arabidopsis homology: Chromosome 1 [354609-354712] Plus strand
FITO62 / BH007441 / pentanucleotide / GGAAGGGAAG / Primary Arabidopsis homology: Chromosome 4 [14730412-14730491] Plus strand
FITO63 / BH007458 / trinucleotide / CCGCCGCCGCCGCCG / No information available at this timermation available at this timermation available
FITO64 / BH007461 / dinucleotide / CTCTCTCTCTCTCT / Primary Arabidopsis homology: Chromosome 3 [226350-226777] Minus strand
FITO65 / BH007461 / pentanucleotide / AATAAAATAAAATAAAATAA / Primary Arabidopsis homology: Chromosome 3 [226350-226777] Minus strand
FITO66 / BH007464 / tetranucleotide / AATAAATAAATA / No information available at this timermation available at this timermation available
FITO67 / BH007468 / pentanucleotide / TTGAATTGAA / No information available at this timermation available at this timermation available
FITO68 / BH007482 / tetranucleotide / TTCTTTCTTTCT / Primary Arabidopsis homology: Chromosome 1 [24943039-24943103] Plus strand
FITO69 / BH007487 / pentanucleotide / GGAGAGGAGA / No information available at this timermation available at this timermation available
FITO70 / BH007487 / dinucleotide / ATATATATAT / No information available at this timermation available at this timermation available
FITO71 / BH007491 / trinucleotide / GAAGAAGAAGAA / No information available at this timermation available at this timermation available
FITO72 / BH007502 / dinucleotide / CTCTCTCTCT / Primary Arabidopsis homology: Chromosome 5 [20690920-20691048] Plus strand
FITO73 / BH007539 / dinucleotide / CTCTCTCTCT / No information available at this timermation available at this timermation available
FITO74 / BH007550 / pentanucleotide / CAACTCAACT / No information available at this timermation available at this timermation available
FITO75 / BH007556 / tetranucleotide / TATCTATCTATATATCTATC / No information available at this timermation available at this timermation available
FITO76 / BH007558 / dinucleotide / ATATATATAT / Chloroplast genome
FITO77 / BH007573 / dinucleotide / TCTCTCTCTC / Primary Arabidopsis homology: Chromosome 1 [13123804-13123890] Minus strand
FITO78 / BH007573 / dinucleotide / TCTCTCTCTC / Primary Arabidopsis homology: Chromosome 1 [13123804-13123890] Minus strand
FITO79 / BH007619 / dinucleotide / (AG)8AA(AG)8 / Primary Arabidopsis homology: Chromosome 5 [25484540-25484661] Minus strand
FITO80 / BH007660 / pentanucleotide / TCAAATCAAA / No information available at this timermation available at this timermation available
FITO81 / BH007660 / pentanucleotide / AAAATAAAAT / No information available at this timermation available at this timermation available
FITO82 / BH007662 / tetranucleotide / TTTATTTATTTATTTTATTTA / No information available at this timermation available at this timermation available
FITO83 / BH007674 / dinucleotide / ATATATATATATATATATAT / No information available at this timermation available at this timermation available
FITO84 / BH007675 / trinucleotide / ATCATCATCATC / Primary Arabidopsis homology: Chromosome 2 [14770937-14770996] Minus strand
FITO85 / BH007682 / dinucleotide / TATATATATA / Chloroplast genome
FITO86 / BH007725 / dinucleotide / AGAGAGAGAGAGAGATAGAGAGAGAGAG / No information available at this timermation available at this timermation available
FITO87 / BH007745 / dinucleotide / GTGTGTGTGTGT / Primary Arabidopsis homology: Chromosome 3 [6160577-6160770] Minus strand
FITO88 / BH007789 / trinucleotide / TCTTCTTCTTCT / Primary Arabidopsis homology: Chromosome 1 [12203565-12203768] Minus strand
FITO89 / BH007805 / pentanucleotide / CTTGCCTTGC / Primary Arabidopsis homology: Chromosome 2 [9831677-9832073] Plus strand
FITO90 / BH007806 / pentanucleotide / CTTGCCTTGC / Primary Arabidopsis homology: Chromosome 4 [3947839-3947999] Minus strand
FITO91 / BH007811 / tetranucleotide / TTCTTTCTTTCT / No information available at this timermation available at this timermation available
FITO92 / BH007812 / tetranucleotide / TTCTTTCTTTCTTTCT / No information available at this timermation available at this timermation available
FITO93 / BH007833 / trinucleotide / CTTCTTCTTCTT / Primary Arabidopsis homology: Chromosome 2 [1406622-1406686] Minus strand
FITO94 / BH007836 / dinucleotide / CACACACACACA / Primary Arabidopsis homology: Chromosome 4 [11558522-11558975] Plus strand
FITO95 / BH007887 / trinucleotide / ACCACCACCACC / No information available at this timermation available at this timermation available
FITO96 / BH007888 / trinucleotide / ACCACCACCACC / No information available at this timermation available at this timermation available
FITO97 / BH007924 / tetranucleotide / TTATTTATTTATTTAT / Primary Arabidopsis homology: Chromosome 1 [10092226-10092359] Minus strand
FITO98 / BH007925 / tetranucleotide / TTATTTATTTATTTAT / Primary Arabidopsis homology: Chromosome 1 [23777549-23778174] Minus strand
FITO99 / BH007957 / pentanucleotide / AAACCAAACCAAACC / No information available at this timermation available at this timermation available
FITO100 / BH007958 / tetranucleotide / ATCTATCTATCTATCT / No information available at this timermation available at this timermation available
FITO101 / BH007998 / trinucleotide / GAAGAAGAAGAA / No information available at this timermation available at this timermation available
FITO102 / BH008068 / trinucleotide / GTTGTTGTTGGTGTTGTGGTTGTTGTT / Primary Arabidopsis homology: Chromosome 2 [18463817-18463917] Minus strand
FITO103 / BH008082 / pentanucleotide / TAAATTAAATTAAAT / No information available at this timermation available at this timermation available
FITO104 / BH008083 / pentanucleotide / TAAATTAAATTAAAT / No information available at this timermation available at this timermation available
FITO105 / BH008085 / pentanucleotide / TTCGGTTCGGTTCGG / No information available at this timermation available at this timermation available
FITO106 / BH008087 / trinucleotide / AATAATAATAAT / No information available at this timermation available at this timermation available
FITO107 / BH008088 / trinucleotide / AATAATAATAAT / No information available at this timermation available at this timermation available
FITO108 / BH008116 / trinucleotide / AATAATAATAAT / No information available at this timermation available at this timermation available
FITO109 / BH008139 / trinucleotide / TCATCATCATCA / Primary Arabidopsis homology: Chromosome 5 [19573363-19573462] Minus strand
FITO110 / BH008193 / trinucleotide / TCTTCTTCTTCTTCTTCTTCT / No information available at this timermation available at this timermation available
FITO111 / BH008203 / trinucleotide / ACAACAACAACA / Primary Arabidopsis homology: Chromosome 2 [15217267-15217638] Minus strand
FITO112 / BH008214 / trinucleotide / AACAACAACAAC / Primary Arabidopsis homology: Chromosome 5 [13599558-13599603] Plus strand
FITO113 / BH008243 / trinucleotide / TTATTATTATTA / No information available at this timermation available at this timermation available
FITO114 / BH008310 / trinucleotide / TTCTTCTTCTTC / Primary Arabidopsis homology: Chromosome 1 [28607434-28607577] Plus strand
FITO115 / BH008328 / pentanucleotide / TTTTCTTTTC / Primary Arabidopsis homology: Chromosome 1 [501773-501900] Minus strand
FITO116 / BH008356 / trinucleotide / AACAACAACAAC / Primary Arabidopsis homology: Chromosome 1 [4596849-4597085] Minus strand
FITO117 / BH008359 / dinucleotide / TGTGTGTGTGTGTGTG / Primary Arabidopsis homology: Chromosome 4 [6827609-6828245] Minus strand
FITO118 / BH008376 / dinucleotide / CTCTCTCTCT / No information available at this timermation available at this timermation available
FITO119 / BH008396 / trinucleotide / CTTCTTCTTCTT / No information available at this timermation available at this timermation available
FITO120 / BH008415 / trinucleotide / AGAAGAAGAAGA / Primary Arabidopsis homology: Chromosome 2 [4110060-4110172] Plus strand
FITO121 / BH008417 / trinucleotide / AGAAGAAGAAGA / Primary Arabidopsis homology: Chromosome 1 [19155711-19155781] Plus strand
FITO122 / BH008422 / dinucleotide / ATATATATATATAT / No information available at this timermation available at this timermation available
FITO123 / BH008434 / tetranucleotide / CCCTCCCTCCCT / No information available at this timermation available at this timermation available
FITO124 / BH008471 / tetranucleotide / TTATTTATTTAT / No information available at this timermation available at this timermation available
FITO125 / BH008495 / tetranucleotide / CAAACAAACAAACAAACAAA / No information available at this timermation available at this timermation available
