Supplementary Information, “Characterization of putative glycosylphosphatidylinositol-anchoring motifs for surface display in the methylotrophic yeast Hansenula polymorpha”
Seon Ah Cheon • Jinhee Jung • Jin Ho Choo • Doo-Byoung Oh • Hyun Ah Kang
S. A. Cheon • J. H. Choo • H. A. Kang
Department of Life Science, College of Natural Science, Chung-Ang University, Seoul, 156-756, Korea
J. Jung • D.-B. Oh
Biochemicals and Synthetic Biology Research Center, Korea Research Institute of Bioscience and Biotechnology, 125 Gwahak-ro, Yuseong-gu, Daejeon, 305-806, Korea
Contents
Supplementary Methods:
Plasmids constructions
Supplementary Table 1 H. polymorpha strains and vectors used in this study.
Supplementary Table 2 Primers used in this study.
Supplementary Fig. 1 In silico identification of putative GPI-proteins of H. polymorpha.
Supplementary Fig. 2 Flowchart of the cell wall fractionation procedure to analyze the locations of GPI-proteins in H. polymorpha.
Supplementary Methods
Plasmids constructions
All vectors constructed in this study are listed in Supplementary Table 1. The 2.2 kb DNA fragment encoding the HpOch1(1-53aa)-msdS-FLAG fragment was obtained by digestion with SpeI/ClaI from pDTMOX-HH1MSF (Cheon et al. 2009) and inserted into the corresponding sites of pDUM2-msdS, which is a modified version of pDUMOX-msdS(HA-HDEL) (Kim et al. 2006) lacking an unique SalI site, resulting in the vector pDUM2-HHMSF. The 0.6 kb DNA fragment containing the partial MOX promoter, α-amylase signal sequence from A. niger, and a c-Myc tag was amplified from pDLMOX-GOD(H) (Kim et al. 2004) using two sequential rounds of PCR with primer sets MOXaa_9F and MOXaa_8B and MOXaa_9F and MOXaa_10B, and cloned between the KpnI and XbaI sites of pDUM2-HHMSF, generating the pDUM2-aaF vector. Then the 1.4 kb msdS fragment generated by digestion with XbaI from pDUM2-HHMSF was reintroduced into the pDUM2-aaF vector, resulting in the pDUM2-aaMSF vector containing the msdS gene fused with the α-amylase signal sequence of A. niger and a c-Myc tag. To construct a positive control vector for msdS surface display, the DNA fragment encoding the C-terminal fragment of Tip1p (40 amino acids) (Kim et al. 2002) was amplified from genomic DNA of the DL1-L strain using PCR primers TIP40_11F_SalI/TIP40_12B_SalI (Supplementary Table 2), and cloned into a SalI site of pDUM2-aaMSF, resulting in pDUM2-aaMSF-Tip40. The DNA fragments encoding the C-terminal fragments (40 amino acids) of ten putative GPI-anchored proteins were amplified from the genomic DNA of the A16 (leu2) strain derivative of CBS4732 (ATCC34438) using the PCR primers listed in Supplementary Table 2, and cloned into SalI or SalI/ClaI sites of pDUM-aaMSF, generating the pDUM2-CCW40, -CRH40, -73/40, -CTS40, -EXG40, -133/40, -SPS40, -135/40, and -518/40 vectors, respectively.
Supplementary Table 1 H. polymorpha strains and vectors used in this study
DL1-LdU / leu2 ura3Δ::lacZ / (Kang et al. 2002)
DL1-g11 / leu2 ura3Δ::lacZ och1Δ::lacZ / (Kim et al. 2006)
CBS3742 (A16) / leu2 / (Lahtchev 2002)
Plasmid name / Description / Reference
pDUM2-msdS / Removed an unique SalI site from pDUMOX-msdS(HA-HDEL), HARS36, HpURA3 / This study
pDUM2-aaF / pMOX- ss*-c-Myc-FLAG / This study
pDUM2-aaMS / pMOX-ss-c-Myc-msdS-FLAG / This study
pDUM2-aaMSF-TIP1 / pMOX-ss-c-Myc-msdS-FLAG-TIP1(C40)** / This study
pDUM2-aaMSF-CCW14 / pMOX-ss-c-Myc-msdS-FLAG-CCW14(C40) / This study
pDUM2-aaMSF-CRH1 / pMOX-ss-c-Myc-msdS-FLAG-CRH1(C40) / This study
pDUM2-aaMSF-73 / pMOX-ss-c-Myc-msdS-FLAG-ORF73(C40) / This study
pDUM2-aaMSF-CTS2 / pMOX-ss-c-Myc-msdS-FLAG-CTS2(C40) / This study
pDUM2-aaMSF-EXG1 / pMOX-ss-c-Myc-msdS-FLAG-EXG1(C40) / This study
pDUM2-aaMSF-133 / pMOX-ss-c-Myc-msdS-FLAG-ORF133(C40) / This study
pDUM2-aaMSF-SPS2 / pMOX-ss-c-Myc-msdS-FLAG-SPS2(C40) / This study
pDUM2-aaMSF-518 / pMOX-ss-c-Myc-msdS-FLAG-ORF518(C40) / This study
pDUM2-aaMSF-135 / pMOX-ss-c-Myc-msdS-FLAG-ORF135(C40) / This study
pDLMOX-GOD(H) / pMOX-ss-GOD-6xHis, HpLEU2 / (Kim et al. 2004)
* ss, A. niger α-amylase signal sequence
** (C40): C-terminal 40 amino acids
Supplementary Table 2 Primers used in this study
Primer Name / Sequences (5’ to 3’)MOXaa_9F_KpnI / acggggtaccttgcatcct
MOXaa_8B / ttctgagatgagtttttgttcggccaaagcaggtgccgc
MOXaaCM_10B / tcttctagacagatcctcttctgagatgagtttttgttc
TIP40_11F_SalI / tagtgggtcgacgctggatctagctccgct
TIP40_12B_SalI / catgctgtcgacttacataagcagagctgcaag
CCW1_C40_1F_SalI / tagtgggtcgacgtttcctcttcttctgcagc
CCW1_C40_2B_SalI / catgctgtcgacctaaagaagaccgatcaaga
CRH1_C40_1F_SalI / tagtgggtcgacggcaactcctcgtcgcagtct
CRH1_C40_2B_SalI / catgctgtcgacttagatcaaggcgagtccaaac
ORF73_1F_SalI / agtgggtcgacacggcaagcacggccagc
ORF73_2B_ClaI / tccatcgattctatagtacacaaatcagtcc
CTS2_3F_SalI / agtgggtcgactacccagatgagatggatg
CTS2_4B_ClaI / tccatcgatttacgagatgaataccagaat
EXG1_5F_SalI / agtgggtcgacaaatatgcctctgttctgtct
EXG1_6B_ClaI / tccatcgatttacagtaattctagtcctag
ORF333_7F_SalI / agtgggtcgactcgtcaacggtcagaaacg
ORF333_8B_ClaI / tccatcgattcactcaaacataaagcagtg
SPS2_11F_SalI / agtgggtcgacgacggcgaccacgcaaaac
SPS2_12B_ClaI / tccatcgatttagagctgcatagcaagc
ORF135_13F_SalI / agtgggtcgacccacgtgaagacattccg
ORF135_14B_ClaI / tccatcgattctattgaggagacatgaccatc
ORF518_15F_SalI / agtgggtcgactacgatgacgaaggaacttc
ORF518_16B_ClaI / tccatcgattctagatcagggcagccaa
*Restriction enzyme sites were underlined
Supplementary Fig. 1 In silico identification of putative GPI-proteins of H. polymorpha. For screening GPI-anchored proteins, the 5,483 annotated ORFs of the H. polymorpha CBS4732 strain (ATCC34438) were analyzed systemically using bioinformatic analysis programs, including GPI-SOM (Fankhauser and Maser), PredGPI (Pierleoni et al. 2008), big-PI (Eisenhaber et al. 2004), and fragAnchor (Poisson et al. 2007). Further analysis of putative GPI anchored proteins was performed using SignalP 4.1 server for signal peptides (Petersen et al. 2011), Psort II (Nakai and Horton 1999) and WoLF PSORT (Horton et al. 2007) for protein localization, TMHMM (Sonnhammer et al. 1998) for transmembrane domain, NetNGlyc 1.0 server (http://www.cbs.dtu.dk/services/NetNGlyc/) for N-linked glycosylation sites, NetOGlyc 3.1 and 4.0 servers (Julenius et al. 2005; Steentoft et al. 2013) for O-linked glycosylation sites, and CLC Main benchwork (CLC bio) for analyses of BLASTp, protein alignment, protein properties, and amino acid frequencies
Supplementary Fig. 2 Flowchart of the cell wall fractionation procedure to analyze the locations of GPI-proteins in H. polymorpha. The cell wall proteins of H. polymorpha were isolated as described in Materials and Methods
References
Cheon SA, Choo J, Ubiyvovk VM, Park JN, Kim MW, Oh DB, Kwon O, Sibirny AA, Kim JY, Kang HA (2009) New selectable host-marker systems for multiple genetic manipulations based on TRP1, MET2 and ADE2 in the methylotrophic yeast Hansenula polymorpha. Yeast 26:507-521
Eisenhaber B, Schneider G, Wildpaner M, Eisenhaber F (2004) A sensitive predictor for potential GPI lipid modification sites in fungal protein sequences and its application to genome-wide studies for Aspergillus nidulans, Candida albicans, Neurospora crassa, Saccharomyces cerevisiae and Schizosaccharomyces pombe. J Mol Biol 337:243-253
Fankhauser N, Maser P (2005) Identification of GPI anchor attachment signals by a Kohonen self-organizing map. Bioinformatics 21:1846-1852
Horton P, Park KJ, Obayashi T, Fujita N, Harada H, Adams-Collier CJ, Nakai K (2007) WoLF PSORT: protein localization predictor. Nucleic Acids Res 35:W585-587
Julenius K, Molgaard A, Gupta R, Brunak S (2005) Prediction, conservation analysis, and structural characterization of mammalian mucin-type O-glycosylation sites. Glycobiology 15:153-164
Kang HA, Sohn JH, Agaphonov MO, Choi ES, M.D. T-A, Rhee SK (2002) Development of expression systems for the production of recombinant proteins in Hansenula polymorpha DL-1. In: Gellissen G, editor. Hansenula polymorpha-Biology and Applications. Weinheim: Wiley-VCH. p 124-146
Kim MW, Kim EJ, Kim JY, Park JS, Oh DB, Shimma Y, Chiba Y, Jigami Y, Rhee SK, Kang HA (2006) Functional characterization of the Hansenula polymorpha HOC1, OCH1, and OCR1 genes as members of the yeast OCH1 mannosyltransferase family involved in protein glycosylation. J Biol Chem 281:6261-6272
Kim MW, Rhee SK, Kim JY, Shimma Y, Chiba Y, Jigami Y, Kang HA (2004) Characterization of N-linked oligosaccharides assembled on secretory recombinant glucose oxidase and cell wall mannoproteins from the methylotrophic yeast Hansenula polymorpha. Glycobiology 14:243-251
Kim SY, Sohn JH, Pyun YR, Choi ES (2002) A cell surface display system using novel GPI-anchored proteins in Hansenula polymorpha. Yeast 19:1153-1163
Lahtchev K (2002) Basic genetics of Hanseula polymorpha. In: Gellissen G, editor. Hansenula polymorpha : biology and applications: Wiley-VCH
Nakai K, Horton P (1999) PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization. Trends Biochem Sci 24:34-36
Petersen TN, Brunak S, von Heijne G, Nielsen H (2011) SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods 8:785-786
Pierleoni A, Martelli PL, Casadio R (2008) PredGPI: a GPI-anchor predictor. BMC Bioinformatics 9:392
Poisson G, Chauve C, Chen X, Bergeron A (2007) FragAnchor: a large-scale predictor of glycosylphosphatidylinositol anchors in eukaryote protein sequences by qualitative scoring. Genomics Proteomics Bioinformatics 5:121-130
Sonnhammer EL, von Heijne G, Krogh A (1998) A hidden Markov model for predicting transmembrane helices in protein sequences. Proc Int Conf Intell Syst Mol Biol 6:175-182
Steentoft C, Vakhrushev SY, Joshi HJ, Kong Y, Vester-Christensen MB, Schjoldager KT, Lavrsen K, Dabelsteen S, Pedersen NB, Marcos-Silva Let al (2013) Precision mapping of the human O-GalNAc glycoproteome through SimpleCell technology. EMBO J 32:1478-1488