Supplementary Information to

Radecket al. “The BacillusBioBrick Box: Generation and Evaluation ofEssential Genetic Building Blocks for Standardized Work with Bacillus subtilis

Additional file 3 [.docx]: Supplemental Figures, Tables and Text.

Contents

Table S1. Plasmids used in this study

Table S2. Bacterial strains used in this study

Table S3. Primers used in this study

Figure S1. Expression of Phom-luxABCDE during growth in different media.

Figure S2. Correlation between reporter output of lacZ and lux.

Figure S3. Determination of luminescence half-life.

Figure S4: Effects of different carbon sources on xylose-dependent induction of PxylA.

Protocols

Luria-Bertani (LB) broth:

Starch plates:

Chemical defined medium (CSE): (100ml)

MOPS-based chemically defined medium (MCSE) (100ml)

Antibiotics

QuikChange Site Directed Mutagenesis

Plasmid Extraction from E. coli - Alkaline Lysis Method

Transformation of Bacillus subtilis (simple)

Competent E. coli cells

β-Galactosidase Assay for B. subtilis (based on Miller, 1972)

Western blot detection of GFP

Detection of Flag-tag on Western blots

Detection of His-tag on Western Blots

Detect strep-tag on Western blots with Strep-Tactin-HRP conjugate (IBA)

Detect HA-tag on Western blots

Detection of cMyc on Western blots

How to work with Bacillus subtilis vectors

Pre-Cloning in E. coli

Linearisation before transformation in B. subtilis

Verification of correct integration

Table S1. Plasmids used in this study

Name / Descriptiona / Source
Plasmids
pAC6 / Vector for transcriptional promoter fusions to lacZ; integrates at amyE; cmr / [25]
pAH328 / Vector for transcriptional promoter fusions to luxABCDE (luciferase); integrates atsacA; cmr / [26]
pDG1662 / Empty vector, integrates at amyE, cmr, spcr, ampr / [23]
pDG1731 / Empty vector; integrates at thrC, spcr, mlsr, ampr / [23]
pAX01 / Vector for xylose-dependent gene expression; integrates atlacA, mlsr, ampr / [24]
pXT / Vector for xylose-inducible gene expression; integrates in thrC; spcr, ampr / [46]
pSB1C3 / Replicative E. coli vector, MCS features rfp-cassette; cmr / [62]
pGFPamy / Vector for transcriptional promoter fusions to gfpmut3; integrates at amyE; cmr, ampr / [63]
pBS1C / Empty vector, integrates at amyE; cmr / This study
pBS2E / Empty vector, integrates at lacA; mlsr / This study
pBS4S / Empty vector, integrates at thrC; spcr / This study
pBS1ClacZ / Vector for transcriptional promoter fusions to lacZ; integrates at amyE; cmr / This study
pBS1ClacZ-0 / pBS1ClacZ without promoter / This study
pBS1ClacZ-PliaI / pBS1ClacZ-PliaI-lacZ / This study
pBS3Clux / Vector for transcriptional promoter fusions to luxABCDE (luciferase); integrates in sacA; cmr / This study
pBS3Clux-0 / pBS3Clux without promoter / This study
pBS3Clux-J23101 / pBS3Clux-J23101-luxABCDE / This study
pBS3Clux-PliaG / pBS3Clux-PliaG-luxABCDE / This study
pBS3Clux-PlepA / pBS3Clux-PlepA-luxABCDE / This study
pBS3Clux-Pveg / pBS3Clux-Pveg-luxABCDE / This study
pBS3Clux-PliaI / pBS3Clux-PliaI-luxABCDE / This study
pBS3Clux-PxylA / pBS3Clux-PxylA-luxABCDE / This study
pBS0KPspac* / Replicative expression vector with constitutive Pspac; pDG148 derivative / This study,[69]
pBS0KPspac*-Flag-gfp / pBS0KPspac*-Flag-gfp / This study
pBS0KPspac*-gfp-Flag / pBS0KPspac*-gfp-Flag / This study
pBS0KPspac*-HA-gfp / pBS0KPspac*-HA-gfp / This study
pBS0KPspac*-gfp-HA / pBS0KPspac*-gfp-HA / This study
pBS0KPspac*-cMyc-gfp / pBS0KPspac*-cMyc-gfp / This study
pBS0KPspac*-gfp-cMyc / pBS0KPspac*-gfp-cMyc / This study
pBS0KPspac*-His-gfp / pBS0KPspac*-His-gfp / This study
pBS0KPspac*-gfp-His / pBS0KPspac*-gfp-His / This study
pBS0KPspac*-StrepII-gfp / pBS0KPspac*-StrepII-gfp / This study
pBS0KPspac*-gfp-StrepII / pBS0KPspac*-gfp-StrepII / This study
pBS0KPspac*-Flag-gfp / pBS0KPspac*-Flag-gfp / This study
pCSlux101 / pAH328-Phom-luxABCDE; promoter fragment amplified with primers TM2377+2474 / This study

cmr, chloramphenicol resistance; kanr, kanamycin resistance; spcr, spectinomycin resistance; mlsr, erythromycin-induced resistance to macrolide, lincosamide and streptogramin B antibiotics (MLS); 0: no insert, but rfp-cassette was removed by cleavage with XbaI and SpeI and religation

Table S2. Bacterial strains used in this study

Name / Descriptiona / Source
E. coli strains
XL1-Blue / recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac F′::Tn10
proABlacIqΔ(lacZ)M15] / Stratagene
B. subtilis strains
W168 / Wild-type, trpC2 / Laboratory stock
TMB1872 / W168 sacA::pBS3Clux-0 / This study
TMB1862 / W168 sacA:: pBS3Clux-J23101-luxABCDE / This study
TMB1856 / W168 sacA:: pBS3Clux-PliaG-luxABCDE / This study
TMB1860 / W168 sacA:: pBS3Clux-PlepA-luxABCDE / This study
TMB1930 / W168 sacA:: pBS3Clux-Pveg-luxABCDE / This study
TMB1858 / W168 sacA:: pBS3Clux-PliaI-luxABCDE / This study
TMB1931 / W168 sacA:: pBS3Clux-PxylA-luxABCDE / This study
TMB1939 / W168 amyE::pBS1ClacZ-0 / This study
TMB1857 / W168 amyE::pBS1ClacZ-PliaI-lacZ / This study
TMB1920 / W168 pBS0KPspac*-Flag-gfp / This study
TMB1921 / W168 pBS0KPspac*-gfp-Flag / This study
TMB1922 / W168 pBS0KPspac*-HA-gfp / This study
TMB1923 / W168 pBS0KPspac*-gfp-HA / This study
TMB1924 / W168 pBS0KPspac*-cMyc-gfp / This study
TMB1925 / W168 pBS0KPspac*-gfp-cMyc / This study
TMB1926 / W168 pBS0KPspac*-His-gfp / This study
TMB1927 / W168 pBS0KPspac*-gfp-His / This study
TMB1928 / W168 pBS0KPspac*-StrepII-gfp / This study
TMB1929 / W168 pBS0KPspac*-gfp-StrepII / This study
SGB171 / W168 sacA::pCSlux101 / This study

0: no insert, but rfp-cassette was removed by cleavage with XbaI and SpeI and religation

Table S3. Primers used in this study

Primer name / Sequence (5'-3')
Oligonucleotides for cloning vectors a
TM2206 / CGTTGTTGCCATTGCTGCCGGCATCGTGGTGTC
TM2207 / gacaccacgatgccggcagcaatggcaacaacg
TM2845 / GTGCGCCAACTACCAGCTCTTTCTCCAGAATGGGCTATACCTC
TM2846 / GAGGTATAGCCCATTCTGGAGAAAGAGCTGGTAGTTGGCGCAC
TM2843 / TTTCGCTAAGGATGATTTCTGG
TM2844 / GATCGGTCTCGAATTGACACCTTGCCCTTTTTTGCC
TM2975 / GATCGGTCTCCCTAGGACTCTCTAGCTTGAGGCATC
TM2976 / GATCGGTCTCCCTAGGAGTTAACAAGAGTTTGTAGA
TM2608 / AAATTATGCATCTTTCGCTAAGGATGATTTCTGG
TM2609 / GACACCTTGCCCTTTTTTGCC
TM2835 / CCAACTACCAGCTCTTTCTACAGTTCATTCAGGGC
TM2836 / GCCCTGAATGAACTGTAGAAAGAGCTGGTAGTTGG
TM2837 / GTACCTGCAGGATAAAAAATTTAGAAGCCAATG
TM2838 / TTAGTCCACTCTCAACTCC
TM2301 / AATTCGCGGCCGCTTCTAGATGGCCGGCACCGGTTAATACTAGTAGCGGCCGCTGCAGG
TM2302 / GATCCCTGCAGCGGCCGCTACTAGTATTAACCGGTGCCGGCCATCTAGAAGCGGCCGCG
TM2885 / GCGTTTGATAGTTGATATCCAGCAGGATCCTGAGCG
TM2886 / CGCTCAGGATCCTGCTGGATATCAACTATCAAACGC
TM2887 / CCCATTAATGAATTGCCGGATAATCTTGATTTTGAAGGCC
TM2888 / GGCCTTCAAAATCAAGATTATCCGGCAATTCATTAATGGG
TM2884 / GATCGGTCTCGCTAGGACACCTTGCCCTTTTTTGCC
TM3005 / GCGACCTTCAGCATCACCGGCATGTCCCCCTGGC
TM3006 / GCCAGGGGGACATGCCGGTGATGCTGAAGGTCGC
TM3011 / ACGTTGTTGCCATTGCTGCTGGCATCGTGGTGTC
TM3012 / GACACCACGATGCCAGCAGCAATGGCAACAACGT
TM3013 / GCCGGACGCATCGTGGCAGGCATCACCGGCG
TM3014 / CGCCGGTGATGCCTGCCACGATGCGTCCGGC
TM3028 / CCTCGACCTGAATGGAAGCTGGCGGCACCTCGCTAACGG
TM3209 / CCGTTAGCGAGGTGCCGCCAGCTTCCATTCAGGTCGAGG
Oligonucleotides for promoters b
TM2891 / GATCGAATTCGCGGCCGCTTCTAGAGCAAAAATCAGACCAGACAAAAGC
TM2892 / GATCACTAGTATCATTCATTCTATTATAAAGGAAAAGC
TM2895 / GATCGAATTCGCGGCCGCTTCTAGAGATTGGCCAAAGCAGAAAGGTCC
TM2896 / GATCACTAGTATCGTTTTCCTTGTCTTCATCTTATAC
TM2899 / GATCGAATTCGCGGCCGCTTCTAGAGAGTCAATGTATGAATGGATACG
TM2890 / GATCACTAGTAACTATTAAACGCAAAATACACTAG
TM2903 / GATCGAATTCGCGGCCGCTTCTAGAGGGAGTTCTGAGAATTGGTATGC
TM2904 / GATCACTAGTAACTACATTTATTGTACAACACGAGC
TM2968 / GATCGAATTCGCGGCCGCTTCTAGAGAAGGCCAAAAAACTGCTGCC
TM2969 / GATCACTAGTATTCGATAAGCTTGGGATCCC
TM2934 / GATCGAATTCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGCAGTAAAGGAGAAGAACTTTTC
TM2935 / GATCACTAGTATTAACCGGTTTTGTAGAGCTCATCCATGC
TM2377 / AATTGTCGACATAAGCTTATCCTGATGGTC
TM2474 / AATTGAGCTCAGGGCTTTCTCTTTTTACAG

aRecognition sites for endonuclease restriction enzymes are in bold, resulting overhangs underlined. Single nucleotides in bold and underlined are introduced mutations at restriction sites.

bIntroduced restriction sites in the overhang shown in bold, annealing part is underlined.

Figure S1. Expression of Phom-luxABCDE during growth in different media.

Wild-type B. subtilis carrying the Phom-luxABCDE reporter construct was grown in LB medium, defined CSE medium, or CSE medium supplemented with 0.1% or 1% casamino acids (CAA) as indicated in the legend. Luminescence output, expressed as relative light units per OD600 (RLU/OD), was monitored over time. Results are shown as the mean and standard error of the mean of two experiments. The approximate extent of the different growth phases is indicated above the graph; trans., transition phase.

Figure S2. Correlation between reporter output of lacZ and lux.

The strains TMB1858 (PliaI-lux) and TMB1857 (PliaI-lacZ) were grown in LB medium and induced with the bacitracin concentrations 0, 0.1, 0.3, 1, 3, 10, 30 and 100 μg ml1. The respective activities show a linear correlation 30 min after induction, as is expected even though the lacZ activity equilibrates on a timescale much longer than the luciferase signal. In fact, when measuring the lacZ activity under two different conditions with protein expression rates 1and 2but, importantly, at the same time T, the fold-change between the protein levels directly reflects the fold-change of the expression rates: Given that the LacZ protein level, Z(t), exponentially approaches its steady state at a timescale given by the cell doubling rate, Z(t) ~ *[1-exp(-*t)],the ratio of the protein levels is independent of time, i.e., Z1(T)/Z2(T) = 1/2. Therefore, we expect a linear correlation between luciferase and lacZ activities even if the latter has not yet reached its steady state level at the reference time point.

Figure S3. Determination of luminescence half-life.

To determine the half-life pof the output of the luciferase reporter system, B. subtilis harboring the Pxyl-luxABCDE reporter construct was grown in CSE medium in the presence of 0.15 % (w/v) xylose under the conditions described for luciferase assays with constitutive promoters. When luciferase activities reached approximately 105 RLU/OD600 (early exponential phase), further protein synthesis was stopped by the addition of 500 µg ml-1 tetracycline, and luminescence and OD600 were monitored every 5 min. The half-life of the luminescence output was determined from a fit of the data from eight replicate assays (symbols) with an exponential decay function (red lines).

Figure S4: Effects of different carbon sources on xylose-dependent induction of PxylA.

Wild-type B. subtilis carrying the PxylA-luxABCDE reporter construct was grown in defined CSE medium supplemented with 2.5 % of different carbon sources in the presence or absence of 0.2 % xylose (Xyl) as indicated in the legend. Luminescence output, expressed as relative light units per OD600 (RLU/OD, top panel) and growth (OD600, bottom panel), were monitored over time. Results are shown as the mean and standard error of the mean of two experiments.

Protocols

Media

Luria-Bertani (LB) broth:

Tryptone / 10 g
Yeast extract / 5 g
NaCl / 10 g
H2O (dest) / ad 1.000 ml
  • for LB plates: add 15 g/l of agar
  • important:cool down the agar solution to 50°C before adding antibiotics

Starch plates:

Nutrient Broth (Difco) / 7,5 g
Starch / 5 g
Agar / 15 g
H2O (dest) / ad 1.000 ml

Chemical defined medium (CSE): (100ml)

5×C-Salts / 20 ml
Tryptophan (5 mg/ml) / 1 ml
Ammoniumeisencitrat (2,2 mg/ml) / 1 ml
III’-Salts / 1 ml
Potassium glutamate (40%) / 2 ml
Sodium succinate (30%) / 2 ml
5×C-Salts (1 l)
KH2PO4 / 20 g
K2HPO4 × 3 H2O / 80 g
(NH4)2SO4 / 16,5 g
III’-Salts (1 l)
MnSO4 × 4 H2O / 0,232 g
MgSO4 × 7 H2O / 12,3 g
  • autoclave (or filtrate) each component separately and put them together freshly before starting your experiment
  • Optionally: addition of media additives, for example pyruvate (0.5% final concentration) or glucose (1% final concentration)

MOPS-based chemically defined medium (MCSE) (100ml)

10×MOPS solution / 10 ml
Tryptophan (5 mg/ml) / 1 ml
Ammonium ferric citrate (2,2 mg/ml) / 1 ml
III’-Salts / 1 ml
Potassium glutamate (40%) / 2 ml
Sodium succinate (30%) / 2 ml
Fructose (20%) / 1 ml
10x MOPS solution (1 l), adjust pH = 7 with KOH (10 M)
( 400 mM MOPS, 10 mM phosphate)
MOPS / 83,72 g
KH2PO4 (1M) / 3,85 ml
K2HPO4 (1M) / 6,15 ml
(NH4)2SO4 / 33 g
III’-Salts (1 l)
MnSO4 × 4 H2O / 0,232 g
MgSO4 × 7 H2O / 12,3 g
  • autoclave (or filtrate) each component separately and put them together freshly before starting your experiment
  • Optionally: addition of media additives, for example pyruvate (0.5% final concentration) or glucose (1% final concentration)

Antibiotics

  • Indicated are 1.000-times stock solutions
  • Dissolve in the specific solvent and filtrate by using 0.2 µm filters
  • Store at -20°C

Strain / Antibiotic / Concentration / Dissolve in / Color code
B. subtilis / Kanamycin / 10 mg/ml / H2O / Black (one bar)
Chloramphenicol / 5 mg/ml / 70% ethanol / Blue
MLS selection: / Red
Erythromycin / 1mg/ml / 70% ethanol
Linkomycin / 25 mg/ml / H2O
Spectinomycin / 100 mg/ml / H2O / Purple
Bacitracin / 50 mg/ml / H2O / -
E. coli / Ampicillin / 100 mg/ml / H2O / Green

QuikChange Site Directed Mutagenesis

  • Primer Design Guidelines
  • Both of the mutagenic primers must contain the desired mutation and anneal to the same sequence on opposite strands of the plasmid.
  • Primers should be between 25 and 45 bases in length, with a melting temperature (Tm) of ≥78°C. Primers longer than 45 bases may be used, but using longer primers increases the likelihood of secondary structure formation, which may affect the efficiency of the mutagenesis reaction.
  • The following formula is commonly used for estimating the Tm of primers:

Tm = 81.5 + 0.41(%GC) - (675/N) - % mismatch

  • N is the primer length in bases
  • values for %GC and % mismatch are whole numbers
  • For calculating Tm for primers intended to introduce insertions or deletions, use this modified version of the above formula:

Tm = 81.5 + 0.41(%GC) - (675/N)

where N does not include the bases which are being inserted or deleted.

  • The desired mutation (deletion or insertion) should be in the middle of the primer with ~10–15 bases of correct sequence on both sides.
  • The primers optimally should have a minimum GC content of 40% and should terminate in one or more C or G bases.

•PCR Reaction

  • Use 125 ng of each primer. To convert nanograms to picomoles of oligo, use the following equation:

X pmoles of oligo = (ng of oligo)/(330 x #of bases in oligo) x 1000

For example, for 125 ng of a 25-mer:

(125 ng of oligo)/(330 x 25 bases) x 1000 = 15 pmole

  • Use standard Phusion PCR protocol with following modifications:

(i)elongation time ~1 minute for 1 kb

(ii)12 cycles (up to 35)

(iii)Annealing temperature 60°C (down to 52)

It usually works well to try different template DNA concentrations (e.g. 5, 10, 20 and 50 ng).

As a control, prepare a reaction without Phusion (should give no colonies)

  • DpnI digest

1 µl DpnI/PCR reaction

Incubate 60 min at 37°C

  • E. coli transformation

According to a standard protocol, with 10 µl PCR reaction

Plasmid Extraction from E. coli - Alkaline Lysis Method

  • Harvest 2-4 ml of cells in eppendorf (13,000rpm, 1 min) Decant supernatant (aspirate)
  • Resuspend cells in 300 µl P1 buffer to a homogenous suspension
  • Add 300 µl of lysis buffer (P2 buffer), invert about 6 times (not more!)
  • Add 300 µl K-Ac/5% formic acid and invert tube approx 6 times. Should see a precipitate form
  • Spin at 13,000 rpm for 10 min then transfer supernatant into new eppendorf
  • Precipitate plasmid DNA in 0.7 vol (i.e. 630 µl) of room temperature isopropanol and invert about 6 times
  • Spin at 13,000 rpm for 15mins and decant supernatant.
  • Wash pellet in 70% ethanol (ca. 700 µl) and remove supernatant, spin again if pellet becomes dislodged.
  • Quick spin to remove final trace ethanol and allow pellet to air dry (approx 10-15 mins)
  • Dissolve DNA in 50-100 µl of MQ H20 (pH5.5) or 10 mMTris/HCl (pH8.0).

Recipes:

P1 Buffer (Recipe from Qiagen kit) (store in fridge)

50mM Tris/HCl [pH 8]

10mM EDTA [pH 8]

Make up part of the final volume with the Tris/HCl and EDTA solutions with water.

100μg/ml DNase-free RNase (from 10 mg/ml stock)

Lysis Buffer (P2) (store at RT, but only make about 10 or 20 ml as it doesn’t keep forever)

0.2M NaOH

1% SDS

K Acetate/5% formic acid (store at RT)

88.3g K-acetate

15ml Formic Acid

300ml volume with dH20

Transformation of Bacillus subtilis (simple)

•inoculate 10 ml MNGE to OD600 = 0,1 (or simply 1/100) from overnight culture

•let grow to OD600 = 1.1-1.3 at 37°C with agitation (at least 200 rpm!)

•use 400 μl cells for transformation (in test-tube, not eppendorf!):

oadd DNA (ca. 1-2 µg linearized plasmid or 100 µl crude-prep genomic DNA)

olet grow for 1 h

oadd 100 µl Expression Mix (may need to pre-induce: Ery 0,025 μg/ml, Cm 0,125 μg/ml)

olet grow for 1 h

oplate on selective media

10 X MN-Medium:

136 gK2HPO4 (x 3 H2O)

60 gKH2PO4

10 gNa-citrat (x 2 H2O)

MNGE-Medium:

9,2 ml1 x MN-Medium (920 µl 10x MN + 8,28 ml sterile water)

1 mlGlucose (20%)

50 µl K-Glutamat (40%)

50 µlFe[III]- ammonium-citrate (2,2 mg/ml)

100 µlTryptophan (5 mg/ml)

30 µlMgSO4 (1M)

(100 µl threonine (5 mg/ml) for strains carrying an insertion in thrC)

Expression Mix:

500 µlyeast extract (5%)

250 µlcasamino-acids (CAA) (10%)

250 µlH2O

50 µlTryptophan (5 mg/ml)

Check for integration: see pages 27-30

Competent E. coli cells

From openwetware:

Overview

This protocol is a variant of the Hanahan protocol [1] using CCMB80 buffer for DH10B, TOP10 and MachI strains. It builds on Example 2 of theBloom05 patentas well. This protocol has been tested on NEB10, TOP10, MachI andBL21(DE3)cells. SeeOWW Bacterial Transformation pagefor a more general discussion of other techniques. TheJesse '464 patentdescribes using this buffer for DH5α cells. TheBloom04patent describes the use of essentially the same protocol for the Invitrogen Mach 1 cells.

This is the chemical transformation protocol used byTom Knightand theRegistry of Standard Biological Parts.

Materials

  • Detergent-free, sterile glassware and plasticware (see procedure)
  • Table-top OD600nm spectrophotometer
  • SOB

CCMB80 buffer

  • 10 mMKOAc pH 7.0 (10 ml of a 1M stock/L)
  • 80 mM CaCl2.2H2O (11.8 g/L)
  • 20 mM MnCl2.4H2O (4.0 g/L)
  • 10 mM MgCl2.6H2O (2.0 g/L)
  • 10% glycerol (100 ml/L)
  • adjust pH DOWN to 6.4 with 0.1N HCl if necessary
  • adjusting pH up will precipitate manganese dioxide from Mn containing solutions.
  • sterile filter and store at 4°C
  • slight dark precipitate appears not to affect its function

Procedure

Preparing glassware and media

Eliminating detergent

Detergent is a major inhibitor of competent cell growth and transformation. Glass and plastic must be detergent free for these protocols. The easiest way to do this is to avoid washing glassware, and simply rinse it out. Autoclaving glassware filled 3/4 with DI water is an effective way to remove most detergent residue. Media and buffers should be prepared in detergent free glassware and cultures grown up in detergent free glassware.

Prechillplasticware and glassware

Prechill 250mL centrifuge tubes and screw cap tubes before use.

Preparing seed stocks

  • Streak TOP10 cells on anSOBplate and grow for single colonies at 23°C [we use XL1 blue]
  • room temperature works well
  • Pick single colonies into 2 ml of SOB medium and shake overnight at 23°C
  • room temperature works well
  • Add glycerol to 15%
  • Aliquot 1 ml samples to Nunccryotubes
  • Place tubes into a zip lock bag, immerse bag into a dry ice/ethanol bath for 5 minutes
  • This step may not be necessary
  • Place in -80°C freezer indefinitely.

Preparing competent cells

  • Ethanol treat all working areas for sterility.
  • Inoculate 250 ml ofSOBmedium with 1 ml vial of seed stock and grow at 20°C to an OD600nm of 0.3. Use the "cell culture" function on the Nanodrop to determine OD value. OD value = 600nm Abs reading x 10
  • This takes approximately 16 hours.
  • Controlling the temperature makes this a more reproducible process, but is not essential.
  • Room temperature will work. You can adjust this temperature somewhat to fit your schedule
  • Aim for lower, not higher OD if you can't hit this mark
  • Fill an ice bucket halfway with ice. Use the ice to pre-chill as many flat bottom centrifuge bottles as needed.
  • Transfer the culture to the flat bottom centrifuge tubes. Weigh and balance the tubes using a scale
  • Try to get the weights as close as possible, within 1 gram.
  • Centrifuge at 3000g at 4°C for 10 minutes in a flat bottom centrifuge bottle.
  • Flat bottom centrifuge tubes make the fragile cells much easier to resuspend
  • Decant supernatant into waste receptacle, bleach before pouring down the drain.
  • Gently resuspend in 80 ml of ice cold CCMB80 buffer
  • Pro tip: add 40ml first to resuspend the cells. When cells are in suspension, add another 40ml CCMB80 buffer for a total of 80ml
  • Pipet buffer against the wall of the centrifuge bottle to resuspend cells. Do not pipet directly into cell pellet!
  • After pipetting, there will still be some residual cells stuck to the bottom. Swirl the bottles gently to resuspend these remaining cells
  • Incubate on ice for 20 minutes
  • Centrifuge again at 3000G at 4°C. Decant supernatant into waste receptacle, and bleach before pouring down the drain.
  • Resuspend cell pellet in 10 ml of ice cold CCMB80 buffer.
  • If using multiple flat bottom centrifuge bottles, combine the cells post-resuspension
  • Use Nanodrop to measure OD of a mixture of 200 μl SOC and 50 μl of the resuspended cells
  • Use a mixture of 200 μl SOC and 50 μl CCMB80 buffer as the blank
  • Add chilled CCMB80 to yield a final OD of 1.0-1.5 in this test.
  • Incubate on ice for 20 minutes. Prepare for aliquoting
  • Make labels for aliquots. Use these to label storage microcentrifuge tubes/microtiter plates
  • Prepare dry ice in a separate ice bucket. Pre-chill tubes/plates on dry ice.
  • Aliquot into chilled 2ml microcentrifuge tubes or 50 μl into chilled microtiter plates
  • Store at -80°C indefinitely.
  • Flash freezing does not appear to be necessary
  • Test competence (see below)
  • Thawing and refreezing partially used cell aliquots dramatically reduces transformation efficiency by about 3x the first time, and about 6x total after several freeze/thaw cycles.

Measurement of competence

  • Transform 50 μl of cells with 1 μl of standard pUC19 plasmid (Invitrogen) (we use pSB1A3)
  • This is at 10 pg/μl or 10-5μg/μl
  • This can be made by diluting 1 μl of NEB pUC19 plasmid (1 μg/μl, NEB part number N3401S) into 100 ml of TE
  • Incubate on ice 0.5 hours. Pre-heat water bath now.
  • Heat shock 60 sec at 42C
  • Add 250 μlSOC
  • Incubate at 37 C for 1 hour in 2 ml centrifuge tubes, using a mini-rotator
  • Using flat-bottomed 2ml centrifuge tubes for transformation and regrowth works well because the small volumes flow well when rotated, increasing aeration.
  • For our plasmids (pSB1AC3, pSB1AT3) which are chloramphenicol and tetracycline resistant, we find growing for 2 hours yields many more colonies
  • Ampicillin and kanamycin appear to do fine with 1 hour growth
  • Add 4-5 sterile 3.5mm glass beads to each agar plate, then add 20 μl of transformation
  • After adding transformation, gently move plates from side to side to re-distribute beads. When most of transformation has been absorbed, shake plate harder
  • Use 3 plates per vial tested
  • Incubate plates agar-side up at 37 C for 12-16 hours
  • Count colonies on light field the next day
  • Good cells should yield around 100 - 400 colonies
  • Transformation efficiency is (dilution factor=15) x colony count x 105/µgDNA
  • We expect that the transformation efficiency should be between 1.5x108and 6x108cfu/µgDNA

References