1
Efficient delivery of C/EBP beta gene into human mesenchymal stem cells via polyethylenimine-coated gold nanoparticles enhances adipogenic differentiation
Joydeep Das1, Yun-Jung Choi1, Hideyo Yasuda1, Jae Woong Han1, Chankyu Park1, Hyuk Song1, Hojae Bae2, and Jin-Hoi Kim1*
1Dept. of Stem Cell and Regenerative Biology, Humanized Pig Research Center (SRC), Konkuk University, Seoul 143-701, South Korea
2Dept. of Bioindustrial Technologies, College of Animal Bioscience and Technology, Konkuk University, Seoul 143-701, South Korea
Running title: Gold nanoparticle mediated gene delivery
Corresponding author:
Jin-Hoi Kim*: ; Fax: +82-2-458-5414
Department of Animal Biotechnology,
Humanized Pig Research Center (SRC),
Konkuk University, Seoul 143-701, South Korea
Supplementary Informations:
Supplementary Table 1: Elemental analysis of AuPEINPs and AuMUAPEINPs
Nanovector / % Nitrogen / % Carbon / % SulphurAuPEI / 9.435 / 22.548 / 0
AuMUAPEI / 8.132 / 24.106 / 0.216
Supplementary Table 2: TGA weight loss and grafting density
Nanovector / % Weight loss oforganic ligand / No. of molecules per nanoparticle / Grafting density
(No. of molecules nm-2)
AuPEI / 52.50 / 34 / 0.43
AuMUAPEI / 70.19 / 412 / 1.62
Supplementary Table 3: Hydrodynamic size and zeta potential of AuPEI-pDNA and AuMUAPEI- pDNA complexes in water.All values are expressed as mean ±SD.
Vectors/Complexes / Diameter (nm) / Zeta potential (mV)AuPEINPs (1.33x 1011) -pDNA (1 g) / 71.23± 6.13 / 28.6± 2.7
AuMUAPEINPs (0.53x 1011) -pDNA (1 g) / 89.31± 0.91 / 21.70± 0.60
Supplementary Table 4: Primer sequences used for PCR
Primer name / Primer sequence / AnnealingC/EBP / F: cacagcgacgactgcaagatcc
R: cttgaacaagttccgcagggtg / 61°C
PPAR2 / F: Tgtctcataatgccatcaggtttg
R: gataacgaatggtgatttgtctgtt / 58°C
AP2 / F: accaggaaagtggctggcat.
R: caggtcaacgtcccttggct / 58°C
GAPDH / F: cttttaactctggtaaagtgg
R: ttttggctcccccctgcaaat / 58°C
Supplementary Figure legends
Figure 1: Gene map.
Figure 2: Mass spectra of 1-[(11-sulfanylundecanoyl)oxy] pyrrolidine-2,5-dione.
Figure 3: UV-VIS spectra of AuPEINPs (a) and AuMUAPEINPs (b) and their complexes with pDNA.
Figure 4:(a) Hydrodynamic diameter and (b) Zeta potential of AuPEINPs and AuMUAPEINPs. All values are expressed as mean ±SD.
Figure 5: Thermogravimetric analysis. First derivative of the weight loss as a function of temperature for bare MUAPEI.
Figure 6: Oil Red O staining 14 days after transfecting the C/EBP gene (a) Oil Red O staining of non-treated control cells cultured in growth media. (b) Oil Red O staining of non-treated control cells cultured in ADM. (c) Oil Red O staining of cells expressing the C/EBP gene transfected with Lipofectamine 2000 and cultured in ADM. (d) and (e) Oil Red O staining of cells expressing the C/EBP gene transfected with AuPEINPs (1.06 × 1011 and 1.33 × 1011 number of particles, respectively) and cultured in ADM. (f) and (g) Oil Red O staining of cells expressing the C/EBP gene transfected with AuMUAPEINPs (0.35 × 1011 and 0.53 × 1011 number of particles, respectively) and cultured in ADM. (h) Quantitative analysis of lipid droplet formation. All values are expressed as mean ± SD.*p < 0.05, **p < 0.01, and ***p < 0.001 versus the control non-transfected group. #p < 0.05, ##p < 0.01, and ###p < 0.001 versus Lipofectamine transfected group.
Figure 7: Optical microscopic images of hMSCs after incubation with the AuPEINP (0.8 x 1011- 2.65 x 1011)-pDNA (1 g) complexes in the medium for 6 h.
Figure 8: Optical microscopic images of hMSCs after incubation with the AuMUAPEINP (0.35 x 1011- 1.05 x 1011)-pDNA (1 g) complexes in the medium for 6 h. Arrows indicate nanoparticle-pDNA complex aggregation.
Figure 9: LDH release in hMSCs, after treatment with different concentrations of AuPEINPs and AuMUAPEINPs for 12h.All values are expressed as mean ±SD.
1