SUPPLEMENTARY INFORMATION

Supplementary Figure S1

Figure S1: The effects of tamoxifen on the cell cycle. MCF7-WT and MCF7-TamR cells were seeded in the presence of 10 µM 4-hydroxytamoxifen or ethanol vehicle, and total DNA content was determined by 7-AAD staining after 72 hours. The results are shown as an average and standard deviation of three biological and two technical replicates.

Supplementary Figure S2

Figure S2: qRT-PCR showing expression of miRNA-375 48hrs after transfection with control or miR-375 precursor.

Supplementary Figure S3

Figure S3: qRT-PCR showing expression of miRNA-375 48hrs after transfection with empty vector: pCMV-MIR or pCMV-MIR-375 expressing vector.

Supplementary Figure S4

Figure S4: qRT-PCR showing expression of miRNA-375 48hrs after transfection with control or inhibitors of miR-375.

Supplementary Figure S5

Figure S5: Effects of microRNA-375 on EMT in various cancer cell lines. a) Transfection with miRNA-375 precursor reduces cell invasion in four mesenchymal cells lines of breast (MDA-MB-231), lung (H1299 and H1703) and ovarian cancer (OVCAR-5). b) In two of the mesenchymal cell lines, epithelial cell markers are induced, whilst mesenchymal cell markers as well as MTDH are reduced upon transfection with miRNA-375.

Supplementary Figure S6

Figure S6: Deconvolution of siRNA pool: qRT-PCR data shows that all four individual siRNAs directed against MTDH have a strong reduction in gene expression, which is comparable to the siMTDH pool. All qRT-PCR data is shown as an average of three biological and three technical repliactes.

Supplementary Table S1: Effects of tamoxifen on WT and TamR cell viability (%). TamR cells have an EC50 of 7,627 µM while WT cells have an EC50 of 7.083 µM.

Tamoxifen (µM) / WT / TamR
0 / 100,00 / 100,00
0,1 / 102,62 / 98,67
1 / 99,61 / 98,01
2,5 / 88,79 / 97,71
5 / 83,46 / 95,91
7,5 / 50,51 / 58,61
10 / 2,49 / 11,87
15 / 0,20 / 0,26
20 / 0,00 / 0,00

Supplementary Table S2: EMT marker genes differentially expressed in TamR vs. WT MCF-7 cells.

EMT markers differentially expressed in TamR vs. WT MCF-7 cells
Gene / Fold Change (log2)
Epithelial markers down-regulated in TamR cells
CDH18 / -3.66
CDH11 / -2.06
PKP1 / -1.03
MUC1 / -0.81
KRT8 / -0.41
KRT19 / -0.38
KRT18 / -0.36
Mesenchymal markers up-regulated in TamR cells
TGFB2 / 3.27
ITGB6 / 3.09
SNAI2 / 1.62
ZYX / 1.48
SMAD3 / 0.91
TGFBR1 / 0.78
ILK / 0.72
MMP9 / 0.33

Supplementary Table S3: List of predicted miRNA-375 Targets produced by miRWalk and other programs: Targetscan, PITA and DIANAmT, which overlaps with overexpressed genes (>0.5 FC log2) in TamR cells compared to WT MCF7.

Predicted targets of miRNA-375
Symbol / Name / logFC TamR compared to WT
ABLIM1 / actin binding LIM protein 1 / 1,28
ACOX1 / acyl-Coenzyme A oxidase 1, palmitoyl / 0,62
AGPAT5 / 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) / 0,88
ALOX5AP / arachidonate 5-lipoxygenase-activating protein / 1,11
ANKRD10 / ankyrin repeat domain 10 / 0,70
ANKRD57 / ankyrin repeat domain 57 / 0,56
ANXA11 / annexin A11 / 1,17
APPL2 / adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 / 0,96
ARL14 / ADP-ribosylation factor-like 14 / 0,74
BCAT1 / branched chain aminotransferase 1, cytosolic / 0,67
C13orf34 / chromosome 13 open reading frame 34 / 0,63
C15orf41 / chromosome 15 open reading frame 41 / 0,90
C18orf1 / chromosome 18 open reading frame 1 / 1,47
C22orf29 / chromosome 22 open reading frame 29 / 0,51
C2CD2 / C2 calcium-dependent domain containing 2 / 1,60
C2orf28 / chromosome 2 open reading frame 28 / 0,50
C3orf23 / chromosome 3 open reading frame 23 / 0,53
C8orf4 / chromosome 8 open reading frame 4 / 1,32
C9orf6 / chromosome 9 open reading frame 6 / 0,76
CACNG4 / calcium channel, voltage-dependent, gamma subunit 4 / 0,89
CEACAM5 / carcinoembryonic antigen-related cell adhesion molecule 5 / 1,91
CEBPG / CCAAT/enhancer binding protein (C/EBP), gamma / 0,60
CNNM1 / cyclin M1 / 0,53
CNTNAP2 / contactin associated protein-like 2 / 1,03
COMMD9 / COMM domain containing 9 / 0,51
CREG2 / cellular repressor of E1A-stimulated genes 2 / 0,64
CRISPLD2 / cysteine-rich secretory protein LCCL domain containing 2 / 0,68
CSRP2 / cysteine and glycine-rich protein 2 / 1,39
CST6 / cystatin E/M / 0,86
CTGF / connective tissue growth factor / 2,43
CYFIP2 / cytoplasmic FMR1 interacting protein 2 / 1,46
DCBLD2 / discoidin, CUB and LCCL domain containing 2 / 1,22
DDX18 / DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 / 0,60
DGKD / diacylglycerol kinase, delta 130kDa / 0,85
DRAM / damage-regulated autophagy modulator / 1,83
ERBB4 / v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) / 0,61
FAM125B / family with sequence similarity 125, member B / 0,65
FAM125B / family with sequence similarity 125, member B / 1,21
FBN2 / fibrillin 2 / 3,42
FGF12 / fibroblast growth factor 12 / 0,93
FIP1L1 / FIP1 like 1 (S, cerevisiae) / 0,54
FXC1 / fracture callus 1 homolog (rat) / 0,51
FZD5 / frizzled homolog 5 (Drosophila) / 0,97
GALNT1 / UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) / 0,79
GCNT1 / glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) / 1,22
GRHL3 / grainyhead-like 3 (Drosophila) / 1,32
HDHD2 / haloacid dehalogenase-like hydrolase domain containing 2 / 0,60
HERPUD1 / homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 / 0,53
HEY1 / hairy/enhancer-of-split related with YRPW motif 1 / 2,56
HMGB3 / high-mobility group box 3 / 0,72
HNMT / histamine N-methyltransferase / 0,80
HOXB9 / homeobox B9 / 1,44
ID1 / inhibitor of DNA binding 1, dominant negative helix-loop-helix protein / 0,72
ID1 / inhibitor of DNA binding 1, dominant negative helix-loop-helix protein / 0,82
KLF5 / Kruppel-like factor 5 (intestinal) / 0,55
LAMC1 / laminin, gamma 1 (formerly LAMB2) / 1,15
LOC401152 / HCV F-transactivated protein 1 / 0,56
MAP4K4 / mitogen-activated protein kinase kinase kinase kinase 4 / 0,99
MATR3 / matrin 3 / 1,05
MITF / microphthalmia-associated transcription factor / 0,61
MMD / monocyte to macrophage differentiation-associated / 1,27
MTDH / metadherin / 0,50
NCOA7 / nuclear receptor coactivator 7 / 1,42
NFIX / nuclear factor I/X (CCAAT-binding transcription factor) / 0,56
PALLD / palladin, cytoskeletal associated protein / 1,51
PCSK6 / proprotein convertase subtilisin/kexin type 6 / 0,74
PCSK6 / proprotein convertase subtilisin/kexin type 6 / 0,84
PDE5A / phosphodiesterase 5A, cGMP-specific / 2,77
PDE8A / phosphodiesterase 8A / 0,57
PDE8B / phosphodiesterase 8B / 1,22
PDGFC / platelet derived growth factor C / 0,76
PFKFB2 / 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 / 0,72
PGM2L1 / phosphoglucomutase 2-like 1 / 1,26
PHACTR2 / phosphatase and actin regulator 2 / 1,10
PLXNA2 / plexin A2 / 0,98
PM20D2 / peptidase M20 domain containing 2 / 0,69
PPP1R9A / protein phosphatase 1, regulatory (inhibitor) subunit 9A / 1,22
PRKD1 / protein kinase D1 / 0,85
PRKX / protein kinase, X-linked / 0,83
PSD3 / pleckstrin and Sec7 domain containing 3 / 0,52
PTPN4 / protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) / 0,56
QKI / quaking homolog, KH domain RNA binding (mouse) / 1,24
RAPGEF1 / Rap guanine nucleotide exchange factor (GEF) 1 / 0,98
RGL1 / ral guanine nucleotide dissociation stimulator-like 1 / 1,55
RNF126 / ring finger protein 126 / 0,67
RNF144A / ring finger protein 144A / 1,07
SC5DL / sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S, cerevisiae)-like / 0,87
SEMA3E / sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E / 1,48
SGMS2 / sphingomyelin synthase 2 / 1,01
SHANK2 / SH3 and multiple ankyrin repeat domains 2 / 0,86
SHB / Src homology 2 domain containing adaptor protein B / 0,68
SLC31A2 / solute carrier family 31 (copper transporters), member 2 / 1,39
SLC35A2 / solute carrier family 35 (UDP-galactose transporter), member A2 / 0,51
SLC35F2 / solute carrier family 35, member F2 / 0,99
SLC7A1 / solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 / 0,65
SMAP1 / stromal membrane-associated GTPase-activating protein 1 / 0,50
SMYD2 / SET and MYND domain containing 2 / 0,61
SNAI2 / snail homolog 2 (Drosophila) / 1,62
SPAG1 / sperm associated antigen 1 / 0,53
SPOCK1 / sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 / 3,20
SRPRB / signal recognition particle receptor, B subunit / 0,58
ST3GAL5 / ST3 beta-galactoside alpha-2,3-sialyltransferase 5 / 0,81
STBD1 / starch binding domain 1 / 0,52
TBC1D4 / TBC1 domain family, member 4 / 0,81
TNS3 / tensin 3 / 3,02
TSC22D2 / TSC22 domain family, member 2 / 1,17
TSHZ3 / teashirt zinc finger homeobox 3 / 1,30
UBE2E2 / ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast) / 0,88
VAPA / VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa / 0,75
VEGFB / vascular endothelial growth factor B / 0,55
WASF3 / WAS protein family, member 3 / 0,87
XKR6 / XK, Kell blood group complex subunit-related family, member 6 / 1,09
ZFP91 / zinc finger protein 91 homolog (mouse) / 0,52
ZNF462 / zinc finger protein 462 / 0,55

Supplementary Table S4: siRNA sequences for silencing of MTDH.

siMTDH / Sequence
#1 / GGUCAAAUAAGGAACGUUU
#2 / UAGGAAAGCUAAACGAACA
#3 / CAGCAGCGUAAACGUGAUA
#4 / GCAAUUGGGUAGACGAAGA

Supplementary Table S5: List of antibodies used for western blot.

Antigen / Company
EGFR / Santa Cruz
ERBB2 / Neomarkers
ERBB3 / Millipore
Estrogen Receptor-α / Millipore
SRC / Cell Signaling Technology
MTDH / Cell Signaling Technology
p27 / BD Bioscience
β-actin / MP biomedicals
Tubulin / Sigma-Aldrich

Supplementary Table S6: List of primers used for qRT-PCR

Primer / UPL Probe # / Sequence
KRT18_forward / 78 / tgatgacaccaatatcacacga
KRT18_reverse / 78 / ggcttgtaggccttttacttcc
ZEB1_forward / 3 / gggaggagcagtgaaagaga
ZEB1_reverse / 3 / tttcttgcccttcctttctg
MMP9_forward / 53 / gaaccaatctcaccgacagg
MMP9_reverse / 53 / gccacccgagtgtaaccata
SNAI2_forward / 7 / tggttgcttcaaggacacat
SNAI2_reverse / 7 / gttgcagtgagggcaagaa
FN_forward / 32 / ctggccgaaaatacattgtaaa
FN_reverse / 32 / ccacagtcgggtcaggag
ZO-1_forward / 66 / cagagccttctgatcattcca
ZO-1_reverse / 66 / catctctactccggagactgc
CDH1_forward / 35 / cccgggacaacgtttattac
CDH1_reverse / 35 / gctggctcaagtcaaagtcc
MTDH_forward / 83 / gaacacctcaaagtgtaacagca
MTDH_reverse / 83 / tgacttttcatttttcttgtcaatct
ACTB_forward / 64 / ccaaccgcgagaagatga
ACTB_reverse / 64 / ccagaggcgtacagggatag
HPRT_forward / 73 / tgaccttgatttattttgcatacc
HPRT_reverse / 73 / cgagcaagacgttcagtcct
GAPDH-forward / 60 / gcccaatacgaccaaatcc
GAPDH_reverse / 60 / agccacatcgctcagacac

Supplementary Table S7: Primer sequences used for 3’UTR cloning of MTDH gene

Primer / Sequence
Longer_Forward / GCGCGCCTCGAGCAAGTCTGAAACTAGCTGGGAATC
Longer_Reverse / GCGCGCGCGGCCGCGACCTCGTGATCCACCTGC
Shorter_Forward / GCGCGCCTCGAGATGTTGTCATTATATTTGACTGTGGTT
Shorter_Reverse / GCGCGCGCGGCCGCTAAGGCCAGTCTTCAGCAAAA
Mutation_Forward / GGTTCAACAGTATTGCGTTGTCAGACTAGGAAAGCTAAAATCGACGAATGGTTTTAGTTTTGCTGAAGACTGGCCTTA
Mutation_Reverse / TAAGGCCAGTCTTCAGCAAAACTAAAACCATTCGTCGATTTTAGCTTTCCTAGTCTGACAACGCAATACTGTTGAACC