Supplementary Table S1: Primer Sequence
Primer Name / Primer Sequence (5’ to 3’) / Sequence previously publishedP1 / P2347 / CCCTAGGATCAGTGCTAGTGC / Conner et al. 2015
P2 / P1792 / TTCCACCAACAACTGGCTGCGCT / Conner et al. 2015
P3 / ATGGGTTCCACCAACAACTGG
P4 / CACCATGGTAACCAACGTCCCC
P5 / ATACAGGTGCGCCATGGCAG
P6 / P1801 / TTCTCATGGCTCCTAGACTCCCAC / Conner et al. 2015
Rice-ADF3-F / TACAGTCCAAAAGGATGCACCG
Rice-ADF3-R / GATCTTTGAGCGCATCGAGACT
Supplementary Table S2: Rice T0 bulk seed flow cytometry.
gPsASGR-BBML transgene positive / Number of BSFC and haploid embryo detection-Individual 1 / Number of BSFC and haploid embryo detection-Individual 2 / cPsASGR-BBML transgene positive / Number of BSFC and haploid embryo detection-Individual 1 / Number of BSFC and haploid embryo detection-Individual 2 / DD45-gPsASGR-BBML transgene positive / Number of BSFC and haploid embryo detection-Individual 1 / Number of BSFC and haploid embryo detection-Individual 2g2 / 3H / 3 D / c1 / no seed / no seed / D1 / 3 H / 3 H
g4 / 2D / 2 D / c2 / 3 D / 3 D / D2 / 3 H / 3 H
g5 / 3 D / 1 D / c3 / no seed / no seed / D3 / 3 H / 3 H
g6 / 3 H / 3 D / c4 / 3 D / N/A / D4 / no seed / N/A
g7a / 3 H / 3 H / c5 / 2 D / 1 D / D5 / 3 H / 3 H
g8 / 3 H / 3 H / c6 / 1 H / 1 D / D6 / 3 H / N/A
g9 / 3 H / N/A / c7 / 3 H / 3 H / D7 / no seed / no seed
g10 / no seed / no seed / c8 / 3 D / 3 D / D8 / 3 H / 3 H
g11 / 3 H / 3 H / c9 / 3 D / 3 D / D9 / 3 D / 3 D
g12 / 3 H / 3 H / c10 / 3 D / 1 D / D10 / 3 H / 3 H
g13 / 3 H / 3 H / c11 / 3 D / 3 D / D12 / no seed / no seed
g15 / no seed / no seed / c12 / 3 H / 3 D / D13 / no seed / no seed
g16 / 2 H / N/A / c13 / no seed / no seed / D14 / 3 H / 3 H
g26 / 3 H / 3 H / c14 / 3 D / 3 D / D15 / 3 H / 3 H
g31 / 3 H / 1 H / c15 / no seed / no seed / D16 / 3 H / 3 H
g33 / 2 H / 1 D / c16 / 3 D / 3 D / D17 / 3 H / 3 H
g34 / 1 H / 3 H / c17 / no seed / no seed / D18 / 3 H / 3 D
c19 / 2 D / no seed / D19 / no seed / no seed
c20 / no seed / no seed / D20 / 3 H / 3 H
c21 / 3 D / no seed / D21 / 3 H / no seed
c22 / 3 D / 3 D / D22 / 3 H / 3 H
c23 / no seed / no seed / D23 / 3 H / 2 H
c25 / 3 H / no seed / D24 / 3 D / 3 D
D25 / 3 H / 3 H
BSFC – Bulk seed flow cytometry.
H – A haploid signal peak was identified in at least one bulk flow sample.
D – No haploid signal peak was identified in any of the bulk flow samples.
N/A - A second transgene positive plant was not confirmed for the line.
no seed - Did not find 5 mature seed on 3 panicles.
a – This line carries a truncated transgene.
Supplementary Table S3:Summary of rice T1 offspring.
Transgene cassette-line number / Number of T1 seed germinated / Number of plants (individual/twins) assayed for genotype and ploidy / % T1 survival / Number of seed producing haploid offspringUntransformed / 20 / 20/0 / 100% / 0
gPsASGR-BBML-
g7u / 19 / 12/2 / 74% / 3
g11ca / 20 / 16/1 / 85% / 1
g26x / 19 / 18/1 / 100% / 2
g34u / 19 / 11/4 / 79% / 2
cPsASGR-BBML-
c7bb / 25 / 19/2 / 84% / 3
c12c / 25 / 25/0 / 100% / 0
DD45-gPsASGR-BBML-
D3a / 25 / 16/4 / 80% / 4
D6c / 25 / 25/0 / 100% / 1
D17b / 25 / 15/1 / 64% / 2
D25c / 25 / 13/1 / 56% / 3
aDwarfing phenotype in T1 offspring unassociated with PsASGR-BBML transgene
bAlbino phenotype in T1 offspring unassociated with PsASGR-BBML transgene
Supplementary Table S4: Rice T1 analysis of gPsASGR-BBML transgene.
gPsASGR-BBMLT1line / Transgene / Number of BSFC and haploid embryo detection / Individual seed flow cytometry (haploid/diploid/
unknown) / gPsASGR-BBML line / Transgene / Number of BSFC and haploid embryo detection / Individual seed flow cytometry(haploid/
diploid/
unknown)
g7u-1 / yes / 5 H / 15/14/0 / g11c-1 / no / no seed
g7u-2 / yes / Haploid (no seed) / g11c-2 / yes / 5 H
g7u-3 / died / nd / g11c-3 / yes / 5 H
g7u-4 / no / 5 D / g11c-4 / no / nd
g7u-5 / no / 5 D / g11c-5 / no / nd
g7u-6 / no / 5 D / g11c-6 / yes / 5 H
g7u-7 / yes / 5 H / g11c-7 / yes / 5 H
g7u-8 / no / 5 D / g11c-8 / yes / 5 H / 5/27/0
g7u-9 / yes / 5 H / g11c-9 / yes / 5 H / 4/16/0
g7u-10 / no / 5 D / g11c-10 / yes / no seed
g7u-11 / no / 5 D / g11c-11 / yes / Haploid
(no seed)
g7u-12-twa / yes / Haploid (no seed) / g11c-12 / no / dwarf - no infloresence
g7u-12-twb / yes / Haploid (no seed) / g11c-13 / no / no seed
g7u-13-twa / yes / Haploid (no seed) / g11c-14 / N/A / dwarf - no infloresence
g7u-13-twb / yes / Haploid (no seed) / g11c-15 / yes / H
g7u-14 / yes / 4 H / 4/29/0 / g11c-16-twa / no / dwarf - no infloresence
g7u-15 / yes / 5 H / g11c-16-twb / no / dwarf - no infloresence
g11c-17 / yes / no seed
g26x-1 / yes / 5 H / g11c-18 / yes / dwarf - no infloresence
g26x-2 / no / 5 D
g26x-3 / no / 5 D / g34u-1 / yes / 5 H
g26x-4 / yes / 5 H / g34u-2 / yes / 5 H
g26x-5 / yes / 1 H / g34u-3 / no / 5 D
g26x-6 / no / 5 D / g34u-4 / no / 5 D
g26x-7 / no / 5 D / g34u-5 / no / nd
g26x-8 / yes / Haploid (no seed) / g34u-6 / no / 5 D
g26x-9 / yes / 5 H / g34u-7-twa / yes / Haploid
(no seed)
g26x-10 / yes / H / g34u-7-twb / yes / Haploid (no seed)
g26x-11 / no / 5 D / g34u-8 / yes / 5 H / 1/23/0
g26x-12 / yes / no seed / g34u-9-twa / yes / 5 H
g26x-13 / yes / 5 H / 4/17/9 / g34u-9-twb / yes / 5 H
g26x-14 / yes / 5 H / g34u-10-twa / yes / Haploid (no seed)
g26x-15 / yes / 5 H / 6/22/2 / g34u-10-twb / yes / Haploid (no seed)
g26x-16 / no / 5 D / g34u-11 / no / 5 D
g26x-17 / no / nd / g34u-12 / yes / 5 H
g26x-18 / yes / 5 H / g34u-13 / no / 5 D
g26x-19-twa / yes / Haploid (no seed) / g34u-14-twa / yes / 4 H
g26x-19-twb / yes / no seed / g34u-14-twb / yes / 4 H
g34u-15 / no / 5 D
BSFC – Bulk seed flow cytometry
H – A haploid signal peak was identified in at least one bulk flow sample.
D – No haploid signal peak was identified in any of the bulk flow samples.
nd -No seed flow analysis done.
Supplementary Table S5: Rice T1 analysis of cPsASGR-BBML transgene.
cPsASGR-BBMLT1 line / Transgene / Number of BSFCand haploid embryo detection / cPsASGR-BBMLT1 line / Transgene / Number of BSFC and haploid embryo detectionc7b-1 / Y / 2 D / c12c-1 / N / nd
c7b-2 / Y / 2 H / c12c-2 / Y / 2 D
c7b-3 / Y / 2 H / c12c-3 / Y / 2 D
c7b-4 / Y / 2 D / c12c-4 / N / 3 D
c7b-5 / Y / 2 D / c12c-5 / N / nd
c7b-6 / N / 3 D / c12c-6 / N / nd
c7b-7 / Y / 2 D / c12c-7 / N / nd
c7b-8 / Y / 2 D / c12c-8 / N / 3 D
c7b-9 / Y / Haploid (no seed) / c12c-9 / N / nd
c7b-10 / Y / 2 D / c12c-10 / Y / 2 D
c7b-11 / Y / 2 D / c12c-11 / Y / 2 D
c7b-12-twa / Y / Haploid (no seed) / c12c-12 / Y / 2 D
c7b-12-twb / Y / Haploid (no seed) / c12c-13 / Y / 2 D
c7b-13 / Y / albino-TC / c12c-14 / Y / 2 D
c7b-14 / Y / albino-TC / c12c-15 / N / nd
c7b-15 / Y / albino-TC / c12c-16 / Y / 2 D
c7b-16-twa / N / albino-TC / c12c-17 / Y / 2 D
c7b-16-twb / Y / albino-TC / c12c-18 / N / nd
c7b-17 / Y / albino-TC / c12c-19 / Y / 2 D
c7b-18 / Y / albino-TC / c12c-20 / Y / 2 D
c7b-19 / N / albino-TC / c12c-21 / Y / nd
c7b-24 / Y / No seed / c12c-22 / Y / 2 D
c7b-25 / Y / Haploid (no seed) / c12c-23 / N / nd
c12c-24 / Y / 2 D
c12c-25 / Y / 2 D
BSFC – Bulk seed flow cytometry
H – A haploid signal peak was identified in at least one bulk flow samples.
D – No haploid signal peak was identified in any of the bulk flow samples.
nd - No seed flow analysis done.
Supplementary Table S6: Rice T1 analysis of DD45-gPsASGR-BBML transgene.
DD45-gPsASGR-BBML line / Transgene / Number of BSFC and haploid embryo detection / DD45-gPsASGR-BBML line / Transgene / Number of BSFC and haploid embryo detectionD3a-1 / Y / 2 D / D6c-1 / Y / 2 D
D3a-2 / N / nd / D6c-2 / Y / 2 D
D3a-3 / Y / 3 H / D6c-3 / Y / 2 D
D3a-4 / died / nd / D6c-4 / Y / 2 H
D3a-5 / Y / 1 H / D6c-5 / Y / 2 H
D3a-6 / N / nd / D6c-6 / N / 3 D
D3a-7 / N / nd / D6c-7 / Y / Haploid (no seed)
D3a-8 / N / nd / D6c-8 / N / nd
D3a-9 / Y / 2 H / D6c-9 / Y / 2 D
D3a-10 / N / nd / D6c-10 / Y / 2 H
D3a-11 / Y / 2 H / D6c-11 / N / nd
D3a-12 / Y / 2 H / D6c-12 / Y / 2 H
D3a-13 / N / nd / D6c-13 / N / 3 D
D3a-14 / N / 3 D / D6c-14 / Y / 2 H
D3a-15 / N / nd / D6c-15 / N / nd
D3a-16-twa / Y / Haploid (no seed) / D6c-16 / Y / 2 H
D3a-16-twb / Y / No seed / D6c-17 / N / nd
D3a-17-twa / Y / Haploid (no seed) / D6c-18 / N / nd
D3a-17-twb / Y / Haploid (no seed) / D6c-19 / Y / 2 H
D3a-18 / died / nd / D6c-20 / N / nd
D3a-19 / Y / Haploid (no seed) / D6c-21 / Y / 2 D
D3a-20-twa / N / nd / D6c-22 / Y / 2 H
D3a-20-twb / N / nd / D6c-23 / N / nd
D3a-22 / Y / 2 D / D6c-24 / Y / 2 D
D3a-24-twa / Y / Haploid (no seed) / D6c-25 / Y / 1 H
D3a-24-twb / Y / Haploid (no seed)
D3a-25 / died / nd / D25c-1 / Y / 2 H
D25c-2 / Y / 2 H
D17b-1 / died / nd / D25c-3 / Y / 2 H
D17b-2 / died / nd / D25c-4 / Y / 3 H
D17b-3 / Y / 2 D / D25c-5 / Y / 2 H
D17b-4 / N / 3 D / D25c-6 / Y / 2 H
D17b-5 / N / nd / D25c-7 / Y / 2 H
D17b-6 / N / nd / D25c-8 / Y / 2 D
D17b-7 / Y / 2 H / D25c-9 / Y / 2 D
D17b-8 / died / nd / D25c-10 / Y / Haploid (no seed)
D17b-9 / Y / 2 D / D25c-11 / Y / Haploid (no seed)
D17b-10 / died / nd / D25c-12 / died / nd
D17b-11 / Y / 2 D / D25c-13-twa / Y / Haploid (no seed)
D17b-12 / N / 3 D / D25c-13-twb / Y / 2 H
D17b-13 / Y / 1 H / D25c-24 / Y / Haploid (no seed)
D17b-14 / Y / 2 D / D25c-25 / Y / 3 H
D17b-15 / died / nd
D17b-16 / Y / 2 D
D17b-17 / Y / 2 H
D17b-18 / died / nd
D17b-19 / died / nd
D17b-20-twa / died / nd
D17b-20-twb / Y / Haploid (no seed)
D17b-21 / Y / 2 D
D17b-22 / Y / 1 H
D17b-23 / N / nd
D17b-24 / Y / Haploid (no seed)
D17b-25 / died / nd
BSFC – Bulk seed flow cytometry
H – A haploid signal peak was identified in at least one bulk flow samples.
D – No haploid signal peak was identified in any of the bulk flow samples.
nd - No seed flow analysis done.
Supplementary Table S7: Maize T0 bulk seed flow cytometry results.
gPsASGR-BBML transgene positive / Number of BSFC and haploid embryo detection -Individual 1 / Number of BSFC and haploid embryo detection - Individual 2 / DD45-gPsASGR-BBML transgene positive / Number of BSFC and haploid embryo detection -Individual 1 / Number of BSFC and haploid embryo detection - Individual 234 / no seed / no seed / 2 / 2 H / 3 H
35 / 3 H / N/A / 3 / 3 H / 3 H
36 / 3 D / 3 D / 4 / 3 D / 3 D
37 / 3 D / no seed / 5 / 3 H / 3 H
38 / 3 D / 3 D / 6 / 3 H / 3 D
39 / 3 D / no seed / 7 / no seed / no seed
40 / 1 H / no seed / 8 / 3 H / N/A
42 / 3 H / 2 D / 9 / 3 H / 3 H
44 / 2 H / no seed / 10 / no seed / no seed
45 / no seed / no seed / 11 / 3 D / 3 D
46 / 2 H / 3 D / 12 / 2 D / no seed
47 / 1 H / no seed / 13 / no seed / N/A
48 / no seed / no seed / 14 / 2 H / 3 D
49 / no seed / no seed / 15 / 3 H / 2 H
50 / 3 D / no seed / 16 / no seed / no seed
51 / no seed / no seed / 17 / 3 H / 3 H
52 / 2 H / 3 H / 18 / 3 H / no seed
53 / 3 D / 3 D / 19 / no seed / no seed
54 / no seed / no seed / 20 / 3 H / 3 D
55 / 3 D / no seed / 22 / no seed / N/A
56 / 3 D / 3 D / 23 / 3 D / 3 D
57 / 3 H / 3 D / 24 / 3 H / 3 H
58 / 2 D / no seed / 25 / 3 H / no seed
59 / no seed / no seed / 26 / 3 H / 3 H
60 / no seed / N/A / 27 / 3 H / 3 H
BSFC – Bulk seed flow cytometry
H – A haploid signal peak was identified in at least one bulk flow sample.
D – No haploid signal peak was identified in any of the bulk flow samples.
N/A -No additional plant in line with transgene
no seed - <25 kernels on cob
Supplementary Table S8: Maize T1 analysis of DD45-gPsASGR-BBML transgene.
T1 Diploid plant / DD45-gPsASGR-BBML transgene / Approximate seed count / Number of BSFC and haploid embryo detection / Individual seed flow cytometry (haploid/diploid/
unknown) / T1 haploid plant (colchicine treated) / DD45-gPsASGR-BBML transgene / seed count / Individual seed flow on viviparous kernels (haploid/diploid
/unknown)
45-15b-4 / yes / 75 / 3 H / 45-17a-1 / yes / 0
45-17b-2 / yes / 15 / nd / 45-17b-10 / yes / 0
45-17b-4 / no / 150 / 4 D / 45-18b-1 / yes / 4
45-17b-6 / yes / 150 / 4 H / 8/21/1 / 45-27b-1 / yes / 0
45-24a-1 / yes / >250 / 4 H / 45-27c-4 / yes / 0
45-24a-2 / yes / >250 / 4 D / 45-3d-6 / yes / 0
45-24a-3 / yes / 200 / 4 H / 45-5a-2 / yes / 0
45-24a-5 / no / 100 / 4 D / 45-5b-3 / yes / 7
45-24a-7 / yes / >250 / 4 D / 45-5b-4 / yes / 0
45-24a-9 / yes / >100 / 4 H / 6/23/1 / 45-5b-6 / yes / 14
45-24d-1 / no / 75 / nd / 45-5b-7 / yes / 0
45-24d-2 / no / 100 / nd / 45-5b-8 / yes / 14 / 2/1/1
45-24d-3 / no / 50 / nd / 45-5c-1 / yes / 22 / 5/0/1
45-27b-3 / yes / 75 / 3 H / 45-5c-2 / yes / 0
45-27c-1 / no / >100 / 4 D / 45-5c-3 / yes / 0
45-27-c5 / yes / 75 / 3 H / 5/21/0 / 45-5c-8 / yes / 16 / 4/3/0
45-27c-6 / no / >100 / 4 D / 45-6a-1 / yes / 0
45-27c-9 / yes / 50 / 3 H
45-3a-1 / yes / >250 / 3 H / 11/20/0
45-5a-4 / yes / 20 / 4 H
45-5a-5 / no / >250 / 4 D
45-5c-11 / no / 50 / 4 D
45-5c-4 / yes / 5 / nd
45-5c-5 / no / 50 / nd
45-5c-6 / no / 0 / nd
45-5c-7 / yes / 19 / nd
45-5c-9 / yes / 12 / nd
45-6b-20 / no / 200 / 4 D
45-6b-21 / yes / >250 / 4 D
45-6b-22 / no / 40 / 4 D
45-6b-23 / yes / 200 / 4 H / 0/36/0
BSFC – Bulk seed flow cytometry.
H – A haploid signal peak was identified in at least one bulk flow samples.
D – No haploid signal peak was identified in any of the bulk flow samples.
nd - no seed flow analysis done.
