Supplemental Materials and Methods
Mice and diet. All animal experiments were carried out under protocols approved by the Ohio State University Institutional Laboratory Animal Care and Use Committee. Male C57BL/6 mice (6 weeks old) from Jackson Lab were fed CDAA or CSAA diet. Five mice were used in each diet group for each time point.Lombardi’s choline-deficient (0g/Kg), low methionine (1.7g/Kg) and amino acid-defined diet (CDAA diet, #518753) from Dyets Inc.(Philadelphia, PA, USA) was used to feed mice for different time periods. As a control diet, we used choline sufficient (14.48g/Kg), amino acid defined diet (CSAA diet, #518754) fortified with methionine (4g/Kg). Both diets were supplemented with AIN-76A Vitamin mix (#300050), providing 0.2% Folic acid (w/w) to the diet.
Antibodies: Proteins extracted from cells or liver tissues were immunoblotted with anti-TIMP3 (cat# 6836)(Santa Cruz Biotechnology, Santa Cruz, CA, USA), and anti-GAPDH (cat# mAB 374) (Millipore,Billerica, MA, USA) antibodies following published protocol. Nuclear extracts from liver tissues were immunoblotted with anti-phospho-Smad2 (mAb # 3108), Smad2 (mAb # 3122), Smad4 (# 9515) (cell signaling technology, Danvers, MA, USA)and Ku-70 (sc-17789)(Santa Cruz Biotechnology) antibodies. Thesignal was developed with ECLTM(GE Healthcare,Piscataway, NJ, USA) or Chemiluminescent Peroxidase Substrate (Sigma-Aldrich, St. Louis, MO, USA) after incubation with appropriate secondary antibodies.
Primary culture of mouse hepatocyte: Adult C57BL/6J mice (20-30gms) were anesthetized with ketamine and xylazine given i.p. Livers were perfused with 30 ml of warm (37°C) liver perfusion medium (Invitrogen,Carlsbad, CA, USA) and then with 30 ml of warm (37°C) liver digestion medium (Invitrogen) at a rate of 2 ml/min via the vena cava with the perfusate exiting severed portal vein. The thoracic segment of vena cava was tied to keep perfusate circulating in liver vascular system. The livers were aseptically removed to a sterile Petri dish containing hepatocyte wash medium (Invitrogen) at 4°C to stop digestion. The hepatocyte was released by peeling off hepatic capsule and dispersed by shaking the digested liver in wash medium at 4°C, followed by filtration through gauze. The cells were washed twice and resuspended in serum-containing culture medium (1/3 Waymouth’s medium, 2/3 Minimum Essential Medium, 10% fetal bovine serum, 1% Hepes (pH 7.4), 100 units/ml penicillin G sodium, and 100 μg/ml streptomycin sulfate). Cell count and viability were determined by trypan blue dye exclusion. The cells were plated on 60- or 35-mm dishes coated with rat tail type I collagen (BD Biosciences, San Jose, CA, USA) in the above medium at a density of 1.2x106 cells or 0.4x106 cells per dish, respectively. After incubation for 2h (period of attachment), the cells were used for experiments.
Plasmid construction: TIMP3 cDNA wasPCR amplified from cDNAs reversely transcribed from total normal mouse liver RNA usingspecific primers. TIMP3 cDNA was subsequently cloned into the EcoR I / EcoR V site of p3xFlag-CMV vector. Correct clones were verified by sequencing. The 3’-UTR of TIMP3 were amplified from human genomic DNA using Accuprime Taq polymerase (Invitrogen) and cloned into pDrive vector (Qiagen, Valencia, CA, USA). Inserts were retrieved with Nhe I/Mlu I and cloned into the same sites of a luciferase reporter vector, pIS0, obtained from Addgene, resulting in pIS0-TIMP3-3’UTR. To delete miR-181b sites in TIMP3-3’UTR, pIS0-TIMP3-3’UTR construct was digested with XbaI, resulting in pIS0-TIMP3-3’UTRΔ construct.
Primers used: The following primers were used:
Primers / SequenceTIMP3-cDNA-EcoRI-F / GGAATTCCATGACCCCTTGGCTCGGG
TIMP3-cDNA-EcoRV-R / GGATATCAAGGGGTCTGTGGCATTGATG
TIMP3-3’UTR-F / GCTTCCCTTGGACACTAACTC
TIMP3-3’UTR-R / TGTGATAGAAATAAAACCAC
TIMP3-RT-F / ACGCTGGTCTACACCATCAAGC
TIMP3-RT-R / CCGAAATTGGAGAGCATGTCG
GAPDH-RT-F / TCCTGCACCACCAACTGCTTAG
GAPDH-RT-R / TGCTTCACCACCTTCTTGATGTC
Luciferase assay: Cells (1X105 cells/well) were plated in 24-well plates. Cells were transfected with 100ng pIS0-TIMP3-3’UTR or pIS0-TIMP3-3’UTRΔ, 10ng Renilla luciferase expression vector (pRL-TK) and 600ng MSCV-PIG or MSCV-PIG-miR-181b using lipofectamine 2000. Hep3B cells were transfected with 100ng pIS0-TIMP3-3’UTR or pIS0-TIMP3-3’UTRΔ, 10ng pRL-TK and anti-miR-181b or control RNA (60nM) (Applied Biosystems, Foster City, CA, USA). Luciferase assay was performed after 48h using dual-luciferase reporter assay system (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity.
Isolation of nuclei and preparation of nuclear extract. Nuclei were isolated from the liver as described before(1). Briefly, minced liver tissues were homogenized in high-density sucrose buffer (2M sucrose, 10mM HEPES[pH 7.6], 25mM KCl, 1mM EDTA, 10% glycerol, 0.15mM spermine,0.5mM spermidine, and protease and phosphatase inhibitor cocktails[Sigma]) and isolated by sucrose density gradient centrifugationfollowing Gorski et al. The nuclei were prepared incell lysis buffer (50 mM Tris-HCl (pH8.1), 10mM EDTA, 1% SDS, along with proteaseand phosphatase inhibitor cocktails). The extracts were snap-frozenin small aliquots in liquid N2 and stored at 80°C.
Supplemental Figure Legend
Supplemental Figure 1. Schematic representation of conserved miR-181 sites in TIMP3 3’-UTRs.
Supplemental Figure 2.Northern blot analysis of miR-181b expression in HepG2 and Hep3B cells treated with TGFβ. 5S rRNA was used as a control for RNA loading.
Supplemental Figure 3.Crystal violet staining of colonies formed in Hep3B and SK-Hep1 cells.
Supplemental Figure 4.Hema-3 staining of invading SK-Hep1 cells transfected with anti-miRs and siRNAs.
Supplemental Figure 5.Crystal violet staining of colonies formed in Hep3B and SK-Hep1 cells treated with Doxorubicin.
References
1.Gorski K, Carneiro M, Schibler U. Tissue-specific in vitro transcription from the mouse albumin promoter. Cell 1986;47:767-76.
1