Supplementary Information

Supplementary Material and Methods

Bisulfite sequencing. Genomic DNA was extracted from WM793 and WM793-Res cells using wizard® genomic DNA purification kit (Promega, Madison, WI) and were subsequently subject to bisulfite conversion using MethylCodeTM bisulfite conversion kit (Invitrogen, Boston, MA). PCR reactions were performed with bisulfite-treated DNA and primers as follows: Bim_P_F (5’-ggaagaaaagttggagagtttttg-3’), Bim_P_R (5’-tcactataccctaaatttctaaacc-3’), Bmf_P_F (5’-gggttttattagttgtttg-3’) and Bmf_P_R (5’-ctacccccaaattccctcttaaaa-3’). Purified PCR products were subjected to direct sequencing analysis.

5-azacytidine treatment. Parental and resistant cells were initially treated with 2 μM 5-azacytidine for 24 hours. After that, 5 μM AZD6244 was added and cells were cultured in the presence of both 5-azacytidine and AZD6244 for a further 24 hours before lysis for Western blot analysis.

Chromatin Immunoprecipitation (ChIP). Chromatin immunoprecipitation was performed as previously described(1). Chromatin DNA fragments sheared to 200-500bp was precipitated by using rabbit normal IgG, anti-acetylated histone H3K9 or anti-acetylated histone H4K8. The following primers are used for Bim ChIP PCR: Forward, 5’ggcaaagcaaccttctgatg 3’; Reverse, 5’ cttgtggctctgtctgtaggg 3’

Supplementary References

1.Katiyar P, Aplin AE. FOXD3 regulates migration properties and Rnd3 expression in melanoma cells. Mol Cancer Res 2011; 9: 545-552.

Supplementary Figure Legends

Supplementary Figure 1. Effect of PLX4720 on RAF-MEK-ERK1/2 pathway. Parental and resistant cells were cultured in the absence of PLX4720 for 24 hours. Cells were then challenged with 1 or 5 μM PLX4720 for indicated time before lysed for Western blot analysis on RAF-MEK-ERK1/2 pathway proteins, as indicated. (A) WM793 and WM793-Res cells. (B) M238 and M238-Res cells.

Supplementary Figure 2. Sequencing traces of mutation hot spots in N-RAS, H-RAS, K-RAS, MEK1/2 and B-RAF genes from resistant cells. The mutation status of the hot spot codons is shown above the traces.Bases are colored as follows: green (A), blue (C), red (T), black (G).

Supplementary Figure 3. ERK1/2 reactivation in resistant cells is PDGFRβ-independent. (A) WM793 and WM793-Res cells were treated with imatinib, sorafenib and/or PLX4720, as indicated for 24 hours. Lysates were used forWestern blot analysis. (B) WM793-Res cells were transfected with control or PDGFRβ siRNA for 72 hours and lysed for Western blot analysis.

Supplementary Figure 4. Further characterization of ERK1/2 reactivation in WM793-Res cells(A) Parental and resistant WM793 cells were replated and cultured in the absence of inhibitor for 24 hours. Cells were then treated with either DMSO or 1 μMGDC0879 for further 24 hours and lysed for Western blot analysis with phospho-ERK1/2 and actinantibodies. (B) Parental and resistant WM793 cells were treated with DMSO, PLX4720, AZD6244 and Sorafenib as indicated for 2 hours before lysed for Western blot analysis on phospho-ERK1/2, phospho-MEK and ERK1/2 (loading control). (C) WM793-Res cells were transfected with control non-targeting, A-RAF, B-RAF or C-RAF specific siRNAs alone or in combination in the presence of 5 μM PLX4720 for 72 hours. Cells were then lysed for Western blot analysis on indicated proteins. (D) Parental and resistant cells were treated with DMSO or 5 μM PLX4720 for 24 hours and lysed for Western blotting for Sprouty2 and ERK1/2 (loading control).

Supplementary Figure 5. Bcl-xl is not a major determinant for cytotoxicity resistance. (A) WM793-Res cells were transfected with non-targeting control or Bcl-xl specific siRNAs for 72 hours in the presence of 5μM PLX4720. Bcl-xl knockdown efficiency was examined by Western blot. (B) Annexin V staining of control or Bcl-xl siRNA transfected WM793-Res cells.

Supplementary Figure6. PLX4720-induced Bim-EL and Bmf expression in melanoma cell lines. Melanoma cells (WM35, WM278, A375, SKMel32, WM9 and SKMel24) were treated with DMSO or 1μM PLX4720 for 24 hours. Harvested lysates were analyzed by Western blotting for Bim-EL (A) or qRT-PCR analysis on Bmf (B). Error bars represent standard deviation (N=3).

Supplementary Figure 7. Effect of Bim and Bmf knockdown on the response of 1205Lu cells to PLX4720. 1205Lu cells were treated with control, Bim or Bmf specific siRNAs as indicated for 72 hours. Cells were then treated with DMSO or 1μM PLX4720 for 16 hours and harvested for Western blot (A) or qRT-PCR analysis (B) to examine knockdown efficiency. (C) 1205Lu cells with Bim or Bmf-knockdown were treated with DMSO or 1μM PLX4720 for 48 hours and stained with annexin V-APC for flow cytometry analysis. Error bars represent standard deviation (N=3). * p <0.05,based on two-tail student T test assuming unequal variance.

Supplementary Figure 8. Comparison of Bim-EL expression between PLX4720-treated parental cells and adenovirus infected resistant cells. (A) Lane 1-2: parental WM793 cells treated with DMSO or PLX4720 for 8 hours. Lane 3-7: WM793-Res cells infected with indicated adenovirus for 8 hours. (B) Same as (A) except M238 and M238-Res cells were used.

Supplementary Figure9. Bisulfite sequencing analysis on Bmf and Bim promoters. Representative bisulfite sequencing results of Bmf and Bim promoters are shown in (A) and (C) respectively. Top panel, schematic illustration of Bmf/Bim promoter region. Open box, CpG island. Shaded box, bisulfite sequencing region. +1 arrow, transcription starting site. Middle panel, representative DNA sequence before and after bisulfate treatment. CpG dinucleotides are boxed. Bottom panel, representative sequencing trace. Bases are colored as follows: green (A), blue (C), red (T), black (G). (B) WM793 and WM793-Res cells were treated with DMSO, 5 μM AZD6244 or 2 μM 5-azacytidine, as indicated. Cells were lysed and probed for phospho-ERK1/2, Bim-EL and actin by Western blot.

Supplementary Figure 10. The effect of SAHA on Bim-EL expression and resistant colony formation. (A) WM793-Res cells were treated with two doses of SAHA (2.5 or 5 μM) in the presence of 5μM PLX4720 for 24 hours. The expression level of Bim-EL was analyzed by Western blot. (B)Parental M238 cells were grown to confluence on 6 cm dishes and treated with 5 μM PLX4720 alone or in combination with 5 μM SAHA for 45 days. Medium and drugs were replenished every two days. At the end point, cells were stained with crystal violet. One confluent dish was stained on day 1 as a start point reference.

Supplementary Figure 11. FoxOs are not required for Bim-EL induction by PLX4720 treatment. (A) WM793 and WM793-Res cells were treated with DMSO or PLX4720or PLX4720 plus AZD6244 for 24 hour and lysed for Western blotting with FoxO1, FoxO3a and actin antibodies. (B)WM793 cells were transfected with control non-targeting, FoxO1 or FoxO3a specific siRNAs, as indicated. Seventy-two hours post-transfection, cells were treated with DMSO or 5μM PLX4720 for 24 hours and then lysed for Western blotting on phospho-ERK1/2, FoxO1, FoxO3, Bim-EL and actin.(C) WM793 and WM793-Res cells were treated with DMSO or 5 μM SAHA for 24 hours. Occupancy of acetylated histone H3 or H4 on Bim promoter was evaluated by chromatin immunoprecipitation and PCR. Primer sequences are listed in supplementary material and methods.

1