Understand the Relationship of the Structure and Function of DNA to Protein Synthesis And

Genetics

What is DNA?

Understand the relationship of the structure and function of DNA to protein synthesis and the characteristics of an organism.

True or False?
1.Every cell in your body has roughly the same exact DNA. T / F
2.DNA is made up of the bases A, U, C and G. T / F
3.Codons are four bases in a row. T / F
4.Proteins are sequences of amino acids. T / F
5.mRNA turns into DNA in the process of transcription. T / F
6.One gene forms one protein. T / F

About DNA

“It's in your genes!”

Have you ever been told that you look just like your mother, or that you act just like your brother or sister? You may not think it's true, but there's a good reason that people say that. It's because, in every cell in your body, you have (more or less) the same DNA. As you already know, you get one copy of your DNA from your mother and one from your father. Also, you know that the DNA is split up into strands called chromosomes, and that the ribosomes use the DNA in order to make proteins.

But what does it really mean that this DNA is in every single one of your cells? After considering this for a while, many people ask themselves things like, “Why do the cells in my heart need to have the same information as the cells in my stomach?” It's true that all of the 100 trillion cells in your body have all of the genetic information to be or do anything that your body does. It's also true that your DNA is 3 billion “letters” long; in other words each one of those 100 trillion cells contains 3 billion pieces of information!

Each cell in your body only uses the information that it needs from the DNA; in other words, your heart cells only use the heart information, the stomach cells the stomach information. But the cells carry everything around in case they need to become something else, a power which scientists are just beginning to use for themselves!

So, how does that DNA actually do anything? The trick is that DNA is turned into proteins, and it's the proteins that make a heart cell beat, a nerve cell send messages, and a lung cell take up air. You can think of the relationship between DNA and protein like this: the DNA is like a page of instructions to build a house and the proteins are the wood, steel, nails, screws and glass that actually make up the house. Clearly, to get from the instructions (DNA) to the building materials (proteins), something needs to put it all together – so in steps the ribosomes to actually make the protein!

The instructions contained in DNA are made up of only four bases: the chemicals adenosine (A), thymine (T), cytosine (C) and guanine (G). Each base (or “letter”) has a pair: every A is paired with a T, every T with an A, every C with a G, and every G with a C. Different combinations of these chemicals make “words”, otherwise known ascodons. Codons are made up of three letters in a row: ATG, GCC, ATC, etc. Ribosomes look at each codon and grab a different amino acid. The ribosomes keep adding amino acids until they get to the end of a gene. The string of amino acids that has been made is called a protein.

There is one step in the diagram which has not been mentioned yet. You may have already noticed that the DNA stays in the nucleus but the ribosomes stay outside the nucleus. So, how is it that the ribosomes make proteins from the DNA? There is a messenger that takes the instructions from the nucleus to the ribosomes: it's called messenger RNA (mRNA). As in our example from before, the instructions are contained by the DNA and the actual building materials are the proteins. Often, just like building a house, the instructions cannot be read by simply anyone. It's the job of the mRNA to put the bases into a language that the ribosomes can understand, which is called transcription.

RNA, as we saw with viruses, is very similar to DNA. There is one major difference: where DNA has thiamine (T), RNA has uracil (U). This means that, if a DNAcodon reads “ATA”, then the same codon in RNA will be “AUA”.

In summary, DNA contains the instructions in sets called genes. One gene is converted to mRNA, which goes outside the nucleus of the cell. Outside of the nucleus, the ribosomes read the mRNA, attaching one amino acid for every three base pairs (codon). This sequence of amino acids is a protein. For every gene of DNA, there is one and exactly one protein.

Questions

Do you remember?

1.What are the four bases in DNA? What are they in RNA?

2.What takes the instructions in DNA from the nucleus to the ribosomes?

3.What is a gene?

Think about it!

CTACGCCATATTCGGCGATAC

4.Convert the above DNA sequence into the opposite pair of each base. How many codons does it have?

5.Convert the above DNA sequence into RNA.

Do something!

6.Draw the following steps of how DNA becomes a protein in a Four Door foldable (page Error: Reference source not found). The four doors should contain:

a)A gene of DNA is transcribed into mRNA

b)mRNA leaves the nucleus

c)Ribosomes read the mRNA, adding amino acids

d)The amino acids form a protein

Remember?

7.What are the five kingdoms of living things?

8.Differentiate prokaryotes and eukaryotes in three ways (from this chapter).

9.What are homologous chromosomes?

10.What is cell differentiation?

Human Genome Project

Implications of the Genome Project for Medical Science

By Francis S. Collins, M.D., Ph.D., Victor A. McKusick, M.D., Karin Jegalian, Ph.D.

Virtually every human ailment, except perhaps trauma, has some genetic basis. In the past, doctors took genetics into consideration only in cases like birth defect syndromes and a limited set of illnesses - like cystic fibrosis, sickle cell anemia, and Huntington disease - that are caused by changes in single genes and are inherited according to predictable Mendelian rules.

Common diseases like diabetes, heart disease, cancer, and the major mental illnesses are not inherited in simple ways. But studies comparing disease risk among families show that heredity does influence who develops these conditions. As a result, many doctors are careful to ask patients about their family histories of such illnesses.

Now, with the genome project releasing a torrent of data about human DNA and promoting growing understanding of human genes, the role of genetics in medicine will change profoundly. Genetics will no longer be limited to guiding medical surveillance based on family histories, or classifying the numerous but relatively rare conditions that stem from changes in single genes.

It is true that for many of the most common illnesses, like heart disease, heredity is clearly only one of several factors that contribute to people's overall risk of developing that disease. The most common diseases in developed countries today generally arise from a complex interplay of causes, including diet, lifestyle, and environmental exposures, as well as heredity.

Genetics in the Twentieth Century

The twentieth century saw enormous, even revolutionary, development in the field of genetics. In the spring of 1900, three different scientists brought Mendel's laws of inheritance to a wide audience. This marked the founding of genetics as a scientific discipline. In the middle of the century, Watson and Crick revealed the chemical basis of heredity with their discovery of the double helical structure of DNA. Over the next fifteen years, scientists began to understand the role of RNA as a messenger molecule copied from DNA, and they elucidated the genetic code that allows RNA to be translated to protein.

In 1980 scientists began mapping genes whose variants cause disease. In 1983, for example, mapping localized the Huntington disease gene to chromosome 4. But even after mapping them, finding the genes actually responsible for diseases remained an arduous task. Years of work were required to develop detailed maps over the regions containing long-sought genes, and then to search among the genes in these areas to find the ones specifically desired.

The Human Genome Project

The Human Genome Project (HGP) plan included the decision to map and sequence the genomes of other organisms that have been important to the study of biology: bacteria, yeast, roundworm, fruit fly, and mouse. In addition, the project sought to improve sequencing technology.

From its inception, the HGP has been an international effort. The United States has made the largest investment, but important contributions have come from many countries, including Britain, France, Germany, Japan, China, and Canada. When the project began, the complete human genome sequence was expected by the year 2005, though there was certainly very little reason to be confident then that this goal could be achieved. But one by one, the intermediate milestones were accomplished.

The HGP participants had agreed all along to release all maps and all DNA sequence data into public databases. With access to increasingly detailed maps of the genome, the research community began to identify genes involved in diseases more and more quickly. While less than 10 genes had been identified by the technique known as positional cloning in 1990, that number grew to more than 100 by 1997.

By 1996, with complete genome sequences obtained for several species of bacteria and for yeast, HGP participants decided to attempt sequencing human DNA, at least on a trial scale. The availability of new kinds of sequencing machines and the effort by a newly formed private company to sequence the human genome further spurred the effort. By 1999, confidence grew that HGP participants were ready to sequence the three billion base pairs of the human genome. In June 2000, both the private company and the Human Genome Project's international consortium announced the completion of "working drafts" of the human genome sequence.

Current Genomic Research

The human genome must be sequenced completely. Gaps that remain in the draft sequence must be clarified. This finishing process had been accomplished for chromosomes 21 and 22 by the summer of 2000, and will be carried out for the rest of the genome by 2002.

Genome sequences will be obtained for other organisms. Comparing genome sequences from different species will be a great aid in revealing the genes, since the stretches of DNA that code for protein and the regions in genes that regulate their expression tend to be conserved among species. Large-scale sequencing of laboratory mouse DNA has already started. Projects to sequence rat and zebrafish DNA will not be far behind. Scientists in both the public and private sectors are seriously considering sequencing other large vertebrates' genomes, including those of the pig, dog, cow, and chimpanzee.

Genetics in the Medical Mainstream

Over the next quarter century, the practice of medicine will increasingly depend on an understanding of molecules and genetics.

By the year 2010, predictive genetic tests are likely to be available for many common conditions, allowing individuals who wish to know this information to learn what their individual susceptibilities are, and to take steps to reduce those risks for which interventions are available. The interventions could take the form of medical surveillance, life style modifications, changes in diet, or drug therapy. For example, those at highest risk for colon cancer could undergo frequent colonoscopies for screening, which would prevent many premature deaths. Predictive genetic tests are likely to be applied first in cases where individuals have a strong family history of a particular condition; in fact, such testing is already available for a few conditions, including breast cancer and colon cancer.

But with increasing genetic information available about common illnesses, this kind of genetic risk assessment will become more generally available. Many primary care providers will need to practice genomic medicine; they will need to explain complex statistical risk information to healthy patients who are seeking to maximize their chances of staying well. This will require substantial advances in the understanding of genetics by health care providers. Another crucial step is the passage of legislation that bans the use of genetic information that predicts future risk in decisions about health insurance and employment. Individuals should not have to forgo acquiring genetic information about themselves out of fear of discrimination. Although more than two dozen states have taken some action on the issues of genetic privacy and genetic discrimination, an effective Federal law would help eliminate the patchwork of different levels of protection across the U.S.

Respond

1.What does “genome” mean?

2.What is the purpose of the HGP?

3.Explain, in one paragraph, the role of heredity in developing diseases.

4.Why is it important that genomes be sequenced for other species than humans?

5.What is the purpose of offering genetic tests to patients?

6.Predict three different things that might happen in your life if you tested positive for a genetic disease that limited your ability to walk.

Activities

What a Difference an “A” Makes
In this activity, you will be creating a sequence of amino acids from a sequence of DNA. Then, you will investigate what happens when you make mutations (changes) to that sequence of DNA.
DNA / DNA Replicates / mRNA / tRNA / Amino Acids
T
A
C
A
C
C
C
G
A
A
T
A
A
T
T
1.Fill in the second column (DNA Replicates) with the complementary base pairs of DNA for the DNA in the first column.
2.Fill in the third column (mRNA) with the transcribed mRNA base pairs for the DNA in the first column.
3.Fill in the fourth column (tRNA) with the three-base codons from the mRNA using the chart below.
4.For the last column (Amino Acids), translate the codons into the amino acids that the tRNA adds using the chart below.
5.Assume that the base in position 6 of the original DNA strand mutates to an "A." How will the sequence of #1,2,3, and 4 be affected?
6.Suppose the base in position 2 gets shifted to position 16; how will the sequence of #1,2,3 and 4 (above) be affected?
7.If the base in position 12 is changed to a "T," how will the sequence of #1,2,3 and 4 (above) be affected?
8.Write a paragraph discussing what happened in #5, 6, and 7.
Amino acid / Associated codon(s)
Alanine / GCA, GCC, GCG, GCU
Arginine / AGA, AGG, CGA, CGC, CGG, CGU
Asparagine / AAC, AAU, GAC, GAU
Cysteine / UGC, UGU
Glutamic acid / GAA, GAG
Glutamine / CAA, CAG
Glycine / GGA, GGC, GGG, GGU
Histidine / CAC, CAU
Isoleucine / AUA, AUC, AUU
Leucine / UUA, UUG, CUA, CUC, CUG, CUU
Lysine / AAA, AAG
Methionine (“Start”) / AUG
Phenylalanine / UUC, UUU
Proline / CCA, CCC, CCG, CCU
Serine / AGC, AGU, UCA, UCC, UCG, UCU
Threonine / ACA, ACC, ACG, ACU
Tryptophan / UGG
Valine / GUA, GUC, GUG, GUU
"Stop" codon / UAA, UAG, UGA
DNA from Kiwi Fruit
Materials:

One small Ziploc® bag
Jar or beaker that fits strainer or funnel
Funnel
A #6 coffee filter
Ice-water bath
Water

25% soap solution (1 teaspoon dish soap or shampoo + 3 teaspoons of water)

Kiwifruit, half a kiwi per group of students
Table salt
1 – 20ml test tube per group, preferably with a cap
1 – 10ml test tube per group, preferably with a cap
Ice cold rubbing alcohol stored in freezer or on ice until use

Group Procedure:
1.Get six pieces of kiwi and put them in a Ziploc® bag.
2.Add 20ml of shampoo solution to the Ziploc® bag. Make sure the bag is closed with extra air. (The shampoo solution breaks the cell membrane because the membrane is made of fats.)
3.Mush the kiwi thoroughly but carefully so the bag doesn’t break, for about five minutes.
4.Cool the kiwi mixture in the ice bath for a minute. Then mush the kiwi more. Cool, then mush. Repeat several times.
5.Filter the mixture through cheesecloth. All groups can combine their mixtures at this point, to filter together.
6.Dispense approximately 3 ml of kiwi solution to each test tube, one for each student.
7.Being careful not to shake the tubes, add approximately 2 ml of cold 95% ethanol to each tube. The cooling protects the DNA from being destroyed. In the nuclear membrane it is protected from the DNases in the cell membrane. DNases are in our cells to protect us from viruses.
DNA from Cheek Cells
Materials:

Clear Gatorade OR 0.9% salt water (approx. ½ teaspoon in 8 oz. water)
Small cups (4-8 oz)
30-50 ml test tube or other small container (such as a clear film canister)
25% soap solution (1 teaspoon dish soap or shampoo + 3 teaspoons of water)
Ice cold rubbing alcohol stored in freezer or on ice until use
Teaspoons for measuring

Procedure:
1.Swish 2 teaspoons (10ml) of the Gatorade or salt water from the small cup in your mouth vigorously for 30 seconds. Your goal is to slough off as many cheek cells as possible. Your teacher will time you to make sure you have swished long enough.
2.Spit the water with cheek cells back into the small cup.
3.Pour this solution into a tube containing 1 teaspoon (5ml) of soap solution.
4.Gently mix this solution for 2-3 minutes. Try to avoid creating too many bubbles.
5.The soap solution breaks the cell membranes that are made up of fats, just like the soap breaks down the grease on your dishes.
6.Tilt the tube of soap solution/cells. Pour 2-3 teaspoons (10-15ml) of ice cold alcohol (ETOH) down the side of the tube so that it forms a layer on top of your soapy solution. DO NOT MIX THIS.
7.Let the tube stand for 1-2 minutes.
8.Record your findings.
Codon Bingo

How to play:
1.Fill in your bingo card with amino acids, but don't repeat any of them.
2.When a DNA codon is read off, transcribe it to RNA, then translate it into the amino acid. Place a marker on the square that corresponds to that amino acid.

1Shaw High School