Transcription/Translation Game

Transcription/Translation Game

Gene sequence:CTTGAAACTTCATAAACGGCACTGAAATAG

mRNA sequence:GAACUUUGAAGUAUUUGCCGUGACUUUAUC

tRNAs:cuu gaa acu uca uaa acg gca cug aaa aug

Amino Acids:Leu Glu Thr Ser STOP Thr Ala Leu Lys STOP

Amino Acid (1 letter):L E T S _ T A L K _

Concept

DNA transcription to messenger RNA (mRNA) and its subsequent translation into an amino acid polymer (peptide or protein).

DNA is transcribed into mRNA using the A-T/G-C pairing (but substituting uracil (U) for thiamine (T)). The mRNA is then translated into a peptide sequence using transfer RNA (tRNA) that donates a particular amino acid to the chain. By using the single amino acid codes, words can be made.

The Game

Students are given a DNA sequence and have to go through the steps of transcription and translation in order to “decode” the secret message. Several examples can be done in small groups. Then they can try it in reverse (come up with a word and then go through the process backwards to get the DNA sequence). Students can then send their DNA sequence to another group to decode. Point out why they can’t use the letters J, O, U and X (no amino acids have these letters as their 1 letter abbreviation).

Students may notice the similarity between the DNA and tRNA sequence and take the short cut.

Extension

You can show how mutations in DNA can “mess up” the message. They will probably have made these kinds of mistakes themselves during the game, either by misreading sequences or accidentally adding/deleting letters. Use this to discuss missense mutations (substitution of one base for another, resulting in a codon for a different amino acid), silent mutations (substitution of one base for another, resulting in a codon that codes for the same amino acid), nonsensemutations (accidental addition of a stop codon) and frameshiftmutations (addition or deletion of 1 or 2 bases, resulting in a change in the reading frame).

Genetic Code

Second Position of Codon

T / C / A / G
First Position of Codon / T / Phe / Ser / Tyr / Cys / T / Third Position of Codon
Phe / Ser / Tyr / Cys / C
Leu / Ser / STOP / STOP / A
Leu / Ser / STOP / Trp / G
C / Leu / Pro / His / Arg / T
Leu / Pro / His / Arg / C
Leu / Pro / Gln / Arg / A
Leu / Pro / Gln / Arg / G
A / Ile / Thr / Asn / Ser / T
Ile / Thr / Asn / Ser / C
Ile / Thr / Lys / Arg / A
Met / Thr / Lys / Arg / G
G / Val / Ala / Asp / GGT / T
Val / Ala / Asp / GGC / C
Val / Ala / Glu / GGA / A
Val / Ala / Glu / GGG / G

Amino Acid Abbreviations

One Letter / Three Letters / Amino Acid
A / Ala / alanine
B / Asx / asparagine or aspartate
C / Cys / cysteine
D / Asp / aspartate
E / Glu / glutamate
F / Phe / phenylalanine
G / Gly / glycine
H / His / histidine
I / Ile / isoleucine
K / Lys / lysine
L / Leu / leucine
M / Met / methionine
N / Asn / asparagine
P / Pro / proline
Q / Gln / glutamine
R / Arg / arginine
S / Ser / serine
T / Thr / threonine
V / Val / valine
W / Trp / tryptophan
Y / Tyr / tyrosine
Z / Glx / glutamine or glutamate