Student Directions for Searching the Human Genome Project
1). Save one of the sequences from a word processing program
(cagggttccagggtggctggaccccagat–human insulin(INS) – use in example)
(gggggatattatgaagggccttgagcatct –Student search 1)
(atacgaaaattttccattgtgcaaaagactc –Student search 2)
2).Call up the NCBI URL:
3). Under Nucleotide box pick: nucleotide-nucleotide Blast (blastn)
4). Paste the sequence into the search area
5). Scroll down the page to advanced options
6). Change the option the Homosapiens to limit the search (see screen below)
7). Press the button.
8). A new screen will appear.
9). The Request ID is only important if you initiated several blasts at once.
10). Description and alignments can be reduced to “10” each if desired.
11). Pressing the button will initiate the program to finish searching.
12).You may have to wait several minutes depending on the time of day. Requests on weekends tend to be only a few seconds, as fewer researchers are using the NIH computers.
13).The next screen is shown below.
14). Clickon the hyperlink which will take you to the graphics mode of “ENTREZ GENE”.
15).The screen below should appear with the Official Symbol of the gene and its’ location on the chromosome. This answers question 1 and 2 of the worksheet.
16). Clicking on the hyperlinked Official Symbol (here it is: INS) the screen below appears.
17. A variety of information can be gained under the summary section, but under “Genomic regions, transcripts and products” we see:
18).The sequence is graphically depicted with the exons shown as boxes and the introns as a continuous line between. This answers question three of the student worksheet. The regions of the exons that are coding or are untranslatedare depicted by coloring. By clicking the hyperlink ABOVE the graphical depiction of the gene (red arrow, using GENEBANK), the next window will be the DNA sequence with the number of base pairs listed in the first line (Locus). This answers question 4 of the student worksheet. If you scroll down, under the title “mRNA” the number of exons can be also be determined. By clicking on the hyperlink NEXT to the graphical depiction of the gene (blue arrow,using GENEBANK), the next window will be the mRNA sequence with the number of base pairs listed in the first line (Locus). This will answer question 5 of the student worksheet, finishing the assignment.