Supplementary Figure legends

Figure S1: HEL cells code for p53 M133K and UT7 cells for a truncated p53 protein. (a) Western blotting of HEL and UT7 protein extracts using an anti-p53 antibody and an anti-beta actinantibody as loading control. (b) RT-PCR amplification of the p53 cDNA in HEL and UT7 cells. Plus and minus signs indicate the addition of the reverse transcriptase (or not) during the cDNA synthesis. The p53 cDNA was amplified using the sense primer (5’-ATGGAGGAGCCGCAGTC) and anti-sense primer (5’- TCAGTCTGAGTCAGGCCCTTCT), gel extracted, cloned in the TOPO vector (Invitrogen) and sequenced (8 clones). (c) Schematic drawing of the cDNA identified by sequencing from HEL and UT7 cells. The predicted proteins produced by the mRNA sequences are drawn underneath. AD: activation domain; DBD: DNA binding domain; NLS: Nuclear localization signal; TD: tetramerization domain; BD: binding domain. (d) Examples of sequences of HEL cDNA (bottom) compared to p53 WT cDNA (top). (e) Coimmunoprecipitation between p53 and STAT5A (or STAT5avariants deltaN, lacking aa 1-136, or deltaC, macking aa 749-794) in Ba/F3 cells electroporated with vectors coding for murine STAT5A (or variants) with (middle panel and without p53 (right panel). IgG, isotype control for anti-p53 antibodies. Total cell lysate (TCL)were blotted with anti-STAT5 to see expression of various STAT5A forms.(f, g) G2A (gamma2A cells, deficient in JAK2) were transfected with vectors containing human TpoR (MPL), JAK2, STAT5 (or mutants), p53 (or mutants) and the STAT5-reporter spi-luc along with the pRL-TK-renilla luciferase for control. All cells were treated with 20 ng/ml Tpo in order to activate STAT5.

Figure S2: STAT5 and p53 consensus sites. Sequence logo of the STAT5 (a) and p53 (b) transfac matrices used for the prediction in (Figure 3b).

Figure S3: p53 M133K is not bound to p53 responsive promoters in HEL cells and STAT5B is bound to STAT5 targets. (a) p53 target promoters are not bound by p53 M133K in HEL cells. Black lines indicate the positions of the p53 binding sites. (b) STAT5B is bound to STAT5 responsive promoters in HEL cells and its binding is inhibited by INCB018424 treatment.

Figure S4: Gene ontology of STAT5B and p53-STAT5B targets. (a) Protein information resource keywords enriched for STAT5B and p53-STAT5B targets. (b) Biological process terms enriched for STAT5B and p53-STAT5B targets.

Table S1: Site directed mutagenesis primers.

Table S2: STAT5B and p53 common binding positions. Positions of STAT5B and p53 binding peaks are reported (human genome build hg18). The 244 genomic positions corresponding to STAT5B and p53 binding (columns “Mean_DMSO_STAT5” and “Mean_DMSO_p53”) inhibited upon JAK2 inhibition (columns “Mean_INC_STAT5” and “Mean_INC_p53”) are reported.The list of peaks were filtered using differences of Log2 ratios between mock treatment (DMSO) and JAK2 inhibition treatment (INC)(columns “DMSO.INC”). Upstream and downstream peak neighboring genes are indicated (columns “Gene” and “Gene2”, respectively).

Table S3: qRT-PCR and qPCR-ChIP primers.

Table S4: List of patients’ samples.

1