Cloning of SIRT2 homolog, THD15, in Tetrahymena thermophila
Josiah Hardin, Shannon Harrison
Fall 2009
Abstract
SIRT2 is an incredibly important sirtuin protein in research. It is one of seven mammalian proteins found in Homo sapiens and regulates ribosomal DNA recombination, gene silencing, DNA repair, chromosomal stability and longevity. According to Michan and Sinclair in the BioChem journal, “the mammalian sirtuin, SIRT2, seems to suppress certain brain tumors known as gliomas” (7). Besides this link, “very little is known about the function of SIRT2 in the brain”, although it “may play a role in sensory perception” (Michan and Sinclair, 12). The goal of this project is to provide both data on a homolog of SIRT2 in Tetrahymena thermophila (THD15) and to clone and store this gene so that other researchers may then be able to easily study it.
Introduction
Transcriptional regulation in eukaryotes happens within the chromatin setting and is strongly influenced by the post-translational modification of chromatin. At this time, acetylation is the most understood modification. “In general, increased levels of histone acetylation are associated with increased transcriptional activity, whereas decreased levels of acetylation are associated with repression of gene expression” (De Ruijter et al 2003, 737). Certain proteins can influence acetylation in various ways, and in turn regulate various cell functions such as DNA repair and gene silencing.
“Sirtuins are a conserved family of proteins found in all domains of life” and are “NAD+ dependent deacetylases” (Michan and Sinclair, 1). SIRT2 (a mammalian sirtuin protein) is a tubulin deacetylase in the sirtuin “family of NAD+ dependent deacetylases” (Suzuki and Koike, 600).
In order to study sirtuins more fully, a SIRT2 homolog will be identified in the ciliate Tetrahymena thermophila. This model organism is used for a variety of reasons, most important of which are its two nuclei that have completely different functions and the fact that it grows easily in lab cultures. Being able to study the effects of sirtuin protein in Tetrahymena thermophila will hopefully allow a better idea of exactly what role they play in cell processes and how they work.
After identifying the SIRT2 homolog in Tetrahymena thermophila, we will then amplify the gene, clone it into a plasmid, and store it for later study.
Methods and Materials
Bioinformatics
Using the NCBI website, the amino acid sequence of the protein SIRT2 (Homo sapiens) was found. The gene’s homolog in Tetrahymena thermophila was found via the genome database wiki, The protein sequence and nucleotide sequence of the Tetrahymena homolog were obtained from the genome database wiki and the gene’s start and stop codons were predicted. The Tetrahymena thermophila and Homo sapiens protein sequences were aligned using the genome database. Complete procedure is given in Lab 3: Bioinformatics handout.
Genomic DNA Isolation
The genomic DNA of Tetrahymena was isolated by using 700 µL of urea lysis buffer, 600 µL of phenol:chloroform:isoamyl alcohol (25:24:1), NaCl, isopropyl alcohol, and 70% ethanol to precipitate the DNA. The gDNA was then re-suspended in TE. After diluting the gDNA to 1:100, the spectrophotometer was used to record the absorbance at wavelengths of 260nm and 280nm. Full lab protocol obtained from the handout Lab 4: Tetrahymena Genomic DNA Isolation.
PCR Amplification
Primers were designed using information from bioinformatics. The primers were re-suspended from their dry state and diluted to a working stock of 20 µL primer/180 µL water. The genomic DNA isolated in Lab 4 was used as the template in conjunction with the primers to perform polymerase chain reaction (PCR, Figure 1). Six PCR reactions were set up using 1.3 µL of 1.0 microgram DNA template, 1.0 µL of 0.2 mM TF and TR primer, 0.5 µL of 1.0 Unit Phusion polymerase, 10 µL of 1X GC buffer, 10 µL of 1.0 M Betaine, 1.0 µL of 0.2 mM dNTPs, and 25.5 µL of sterile water. The only difference between them was the DNA template. Three reaction mixes used genomic DNA and three reaction mixes used coding DNA (1:10 dilution of wild-type DNA). Full protocol for this PCR amplification can be found in the handout for Lab 5: Polymerase Chain Reaction (PCR).
Agarose Gel Electrophoresis
Agarose gel was used to perform electrophoresis on the finished PCR reactions. Using a comb, ten wells were made in the 1.5% agarose gel. Two sets of DNA were prepared – one with three samples of gDNA PCR and the other with three samples of cDNA PCR. Each sample contained 1 µL of a xylene cyanol blue and bromphenol blue-purple dye and 10 µL of PCR sample. Each sample was inserted into a well in the gel and a 1kb ladder was used as the control (Figure 2). Lab procedures can be found in the handout Lab Exercise 6: Agarose Gel Electrophoresis.
TOPO Cloning and E. coli Transformation
The TOPO cloning reactions were created by mixing 1 µL PCR product, 1 µL salt solution, 2 µL sterile water, and 1 µL of TOPO vector. 2 µL of the TOPO cloning reaction was added to a vial of chemically competent E. coli cells. The mixture was incubated on ice for ten minutes, heat-shocked for 30 seconds at 42C and immediately transferred back to ice. 250 µL of SOC Medium was added to the reaction and the mixture was shaken horizontally (200rpm) at 37C for one hour. Two plates with 50 µg/µL Kanamycin were prepared. Using sterile glass beads, one plate had 200 µL of the reaction mix spread on it and the other plate had 65 µL of reaction mix spread. The plates were incubated overnight at 37C, removed the next day, and placed at 4C. Complete lab procedures can be found in the handout Lab Exercise 7c: Topo Cloning and E. coli Transformation.
Construction of Plasmid Map and Restriction Enzyme Digestion Design
Using the Gene Construction Kit 3.0 computer program, a plasmid map was constructed. The THD15 gene sequence was inserted into the map. Commonly used restriction enzymes were added to the map and two were determined to have the ability to confirm that the gene had been properly cloned and inserted in the plasmid. A gel run and display table were created to show the expected results of a digest using the two chosen restrictive enzymes, Nhe1 and AvrII. Lab protocol found in Lab 8: Construction of Plasmid Map and Restriction Enzyme Digestion Design.
Plasmid Purification and Restriction Enzyme Digest
Six colonies were chosen from the Topo cloning agar plates (Table 2) and plated on a new agar plate. The same colonies were used to inoculate six 2mL tubes of LB liquid containing 50 µg/µL. The liquid media in each tube was then centrifuged and the supernatant decanted, leaving only the transformed E. coli cells. The cells in each separate tube were re-suspended and lysed using sucrose lysis buffer and lysozyme solution. The mixtures were then centrifuged and the resulting pellets discarded. Genomic DNA from the cloned gene was then precipitated in all six tubes and collected using a base, an alcohol, and a centrifuge. The pellets were re-suspended in TE buffer and then a digest cocktail containing the restriction enzymes AvrII, NheI, BSA, and water was added to the TE buffer. A sample dye containing RNAase was added to the each mixture, and gel electrophoresis performed using identical procedures to above Agarose Gel Electrophoresis procedure and in the handout Lab Exercise 6: Agarose Gel.
Results
Bioinformatics
CACCCTCGAGCATTTAAAAACACTCTTCAAATCATTAATTACTCCAAGTAAGTAAATTACTTTGAGAATATCTAACGTATAGCCAGTTATCAACAGTATTAAATTCGATTAAACAAATCATAGTATACATAACTCAATCTCACATGAAGTATAGGACAGATCTCAAATAATTGAGAATTTTGCTGAGAAGTTGTTAGCAAAAAAATATAAATAGATAGCTTTCTTGACAGGAGCAGGAATTAGTGTAAGTGCTGGAATTCCAGATTTTAGATCTCCTGAAACTGGGCTTTACGCCTAAATAAAAAAAGAATATGACATAAGTGATCCTTAAAAAATATTTTCAATTAGATATTATCAAGATAATCCT
TTGCCTTTTATGCAAGTTATTAGAGATTTCTTTTCAAGAGAATATCACCCAACTTATGCTCATAAGTTAATCCATTAAATCTACAAAAGAAAACAACTATTAATAAATATAACCTAAAATATTGATGGCTTAGAGTTAAAAACAGGGATTAATCCCTCAAAAGTAGTCTAAGCACATGGACATATGAGAAAGGCTCATTGTGTGAATTGCAATCATATTGTCAATATTGAAACTTACTTACAAAACTGCAAACAGTTAAAAAAAACCTAATGCCCCATTTGCAATAATTTAGTGAAGCCAAAAATTGTTTTCTTTGGAGAGTTTCTTCCTAATGAGTTTTATTAGTCTAGAGATATTTTGCCAAATTAGATTGTGTGGTTGTTATGGGAACATCTTTAGGTGTCTTTCCATTTGCTAATTTAATAAACGAAGTAGGTACTTCTGTTCCAATATATATAATAAACAATAAACTTCCTAAAAATATAAGTCATCTTAAAAATCAAATTGAATTTATATAAGGAGATATCAATGAAATTTCTAAATAAATTATTGATTACATAAATTGAAGAGCCTAGG
Figure 1: Genomic sequence for THD15. The intron is marked in red. The forward primer is marked in yellow and the reverse primer is marked in blue. Those marked sections were added to the primer and are not part of the original gene
A260 / 0.150nmA280 / 0.053nm
DNA concentration / .75 µg/µL
Purity / 2.8
Table 1. Quantification of genomic DNA isolation.
THD15 TF
5’-CACCCTCGAGCATTTAAAAACACTCTTCAAATCA
THD15 TR
5’-AGAGCCTAGGTCAATTTATGTAATCAATAATTTATT
Figure 2: Forward and reverse primers designed from bioinformatics.
Figure 3: The gel run from agarose gel electrophoresis. None of the cDNA gel runs are seen. Annealing temperatures are 52.5º C (lanes 1 and 4), 54.5 º C (lanes 2 and 5), and 56.5 º C (lanes 3 and 6) for each of the three respective lanes with the two types of DNA. The first well is a 1 kilobase ladder used for reference in determining band size.
200 µL / 24 Colonies65 µL / 6 Colonies
Table 2: Colony results from TOPO vector cloning.
Figure 4: Plasmid Map. The green band is the inserted THD15 gene. The black portion of it shows the single intron. When the digest occurs there will be 3 fragments in the gel. The plasmid has 3520 base pairs. Magenta is the Kanamycin gene for antibiotic selection and yellow is the pUC origin of replication of the plasmid. Dashed brown lines represent recombination sites used for placing THD15 into the plasmid.
Figure 6. Gel electrophoresis of gene that was Topo cloned (lanes 1-6) into chemically competent E. coli cells digested with AvrII and NheI. Each lane consists of DNA from a different colony.
Results
A SIRT2 homolog was found in Tetrahymena thermophila, THD15. The homolog was found to have two exons, one intron, no expressed sequence tags and an e-value of 4e-44 in relation to the original protein sequence in Homo sapiens (Figure 1). The THD15 gene is 1135 base pairs long. The genomic DNA was isolated and found to have a DNA concentration of 0.75µg/µL and a purity of 2.8 (Table 1). [DNA] (µg/µL) = (A260 * 50 µg/µL * dilution factor)/1000 µL/mL where the dilution factor is 1:100. Purity = A260/A280. Next, polymerase chain reaction was done to amplify the gene using primers designed from the bioinformatics section (Figure 2). Three genomic DNA and three coding DNA reactions underwent this PCR process.
Agarose gel electrophoresis was performed with all six reaction mixes and compared to a 1KB ladder (Figure 3). No bands were present in the cDNA samples in the gel, but the gDNA bands appear to be the correct size both qualitatively and quantitatively.
The first gDNA band (annealing temperature of 52.5C) was chosen as the reaction mix to grow colonies out of. Colonies were grown on agar plates containing 50 µg/µL Kanamycin. The first plate contained 200 µL of a sample containing E. coli, the TOPO cloning reaction, and SOC medium. The second plate contained 65 µL of the same sample. A few days after plating the sample, the plates were viewed, and 24 and 6 colonies were found on the 200µL and 65µL plates respectively (Table 2).
Using the Gene Construction Kit program, a plasmid map containing THD15 was designed (Figure 4). Two restriction enzymes, AvrII and NheI, were chosen and a mock digest table (Table 3) and gel run (Figure 5) were created. The digest will create three gene fragments (Table 3).
The digest was performed with six separate mixtures; each created from a separate colony found on the 200µg/µL agar plate (Table 2). Gel electrophoresis was completed using four of the six colonies used show bands in the gel. Lane six did not show any bands. Lanes one, three, four, and five all showed an expected band of ~266 base pairs and lanes one, three, and five showed a band of ~2100 base pairs. Both of these band sizes correspond to band sizes expected from the digest.
Discussion
Overall, the project went well. The bioinformatics gave a decent homolog of SIRT2. The cDNA did not show up in the agarose gel electrophoresis, giving rise to speculation about what happened. Another lab group did the identical PCR and gel run as we did, and they had cDNA show up in their gel. A couple of ideas: something may have gone wrong during the polymerase chain reaction lab or the dye was not added to the cDNA. I’m very positive that the dye was added, so most likely it was an issue with not getting all the reagents for PCR correct. This is an area that needs more research.
When the restriction enzyme digest was completed, it was discovered that the expected THD15 (4th homolog) did not clone properly, or at least did not show the expected band size in the gel run. There are several possible reasons why this might be. 1) The predicted gene sequence of the fourth homolog was incorrect, and a different base pair length is actually correct. 2) The digest enzymes may have cut the plasmid vector in additional unexpected spots, resulting in two smaller bands that combined would equal the correct band size. 3) The cloning process may have gone wrong at some point and that effected either the gene itself, the base pair length, or both.
Future directions in this research may include two options. The cloned gene may be sequenced to figure out what it actually is. THD15 could be re-cloned in an attempt to get a correct gel run (verifying the cloned gene is in fact THD15) and thereby be able to study the gene further.
Besides the innumerable new terms and techniques I have been forced to hurriedly become associated with, the insight into how research is done was very welcome. Wanting to go on to medical school – where competition is very fierce – having knowledge and experience in research is a must. This project has definitely piqued my interest in the area of research. As far as making this type of research go better in the future, I would suggest a bit more encouragement to delve into the journal articles as soon as possible. Also, having more post labs that just ask basic questions about the lab might not be a bad idea. This would force people to at least try and understand what went on during lab, and would at the least make doing some of the lab notebook and lab report easier.
References
De Ruijter, Annemieke J., Albert H. Van Gennip, Huib N. Caron, Stephan Kemp et al..
"Histone deacetylases (HDACs): characterization of the classical HDAC family." Biochemical 370 (2003): 737-49. Print.
Michan, Shaday, and David Sinclair. "Sirtuins in mammals: insights into their biological
function."Biochem 404 (2007): 1-13. Print.
Suzuki, K. , and T. Koike. "Mammalian Sir2-Related Protein (SIRT) 2–Mediated
Modulation of Resistance to Axonal Degeneration in Slow Wallerian Degeneration Mice: a Crucial Role of Tubulin Deacetylation."Neuroscience147 (2007): 599-612. Print.