SUPPLEMENTAL RESULTS
Characterization of the rictor and sin1 alleles. Rictor deletion mutants were generated by imprecise excision of a P-element inserted in the first intron of the rictor gene (Supplemental Figure 1A). Two deletion mutants (rictorD1 and rictorD2) were revealed by PCR analysis (Supplemental Figure 1B). RT-PCR analysis showed that the mutant flies still expressed mRNA of the deleted products (Supplemental Figure 1C). The Rictor protein contains several regions of conserved sequence (Jacinto et al., 2004 Sarbassov et al., 2004) and the largest conserved area comprises ~200 amino acids with 44% similarity between Rictor proteins from different species (Sarbassov et al., 2004). As the rictor mutant deletions remove this conserved region partially (D1) or completely (D2) and destroy the open reading frame, they are likely to eliminate Rictor activity. This is supported by the loss of AKT phosphorylation in rictor mutant flies, even in the presence of overexpressed PI3K (Figs. 1D and 5C) and the finding that the mutant alleles behave genetically as null, i.e. the growth phenotype of the alleles is not enhanced by placing them in trans to a larger deficiency uncovering the gene (Supplemental Figure 1D) .
The sin1 PiggyBac mutant line was obtained from the Drosophila gene disruption project and it has an insertion of a PiggyBac transposon in the single exon of sin1 gene (CG10105). RT-PCR analysis revealed that the mutated locus still produces short fragment of mRNA upstream of the PiggyBac insertion site (Supplemental Figure 1E). However, as expected expression of the product downstream of the insertion site was severely compromised (Supplemental Figure 1E). As the majority of the conserved regions of Sin1 protein are coded by sequence downstream the PiggyBac insertion, the mutant is likely to lack Sin1 activity. This is supported by the loss of AKT HM phoshorylation and the finding that the mutant alleles behave genetically as null, i.e. the growth phenotype of the allele is not enhanced by placing it in trans to a larger deficiency uncovering the gene (Supplemental Figure 1F).
SUPPLEMENTAL METHODS
RT-PCR analysis. Total RNA was isolated from adult flies by using RNAeasy Mini kit (Qiagen). Genomic DNA was removed by RQ1 DNase (Promega) treatment. cDNA was synthesized from 1 mg of RNA by using SuperScript First-Strand Synthesis System (Invitrogen). PCR was performed by using Phusion polymerase (Finnzymes) and products were visualized by standard agarose gel electrophoresis. The following primers were used:
Rictor F: CCTGTCCAGGCAATGAGCTTG
Rictor R: cgttccgatgtagaggaaatac
Sin1 5’ F: GCGACCTACTCCAACCAGCA
Sin1 5’ R: CGTCGCCAATGATAGTGATC
Sin1 3’ F: TAGCCACTGCCAAAATCCAG
Sin1 5’ R: TGGGAGAAGCCAAACTTAGAG
RP49 F: GCTAAGCTGGTCGCACAAA
RP49 R: TCCGGTGGGCAGCATGTG
SUPPLEMENTAL FIGURE LEGENDS
Supplemental Figure 1. Characterization of rictor and sin1 mutant alleles. (A) deletions of rictor gene were generated by imprecise excision of P-element EY08986 and identified by PCR using primers indicated by arrowheads. (B) Two deletion mutants of the rictor gene (D1 and D2) were identified by PCR of the genomic DNA isolated from individual fly lines. The deletions were verified by sequencing (data not shown). (C) rictor mutant lines still express mRNA of the deleted products. Total RNA was isolated from adult flies and analyzed by RT-PCR using primers complementary to exons 6 and 7 of the rictor gene, as indicated in S1A. Note that splicing from exon 1 to exon 6 leads to loss of open reading frame. RP49 was used as control. (D) rictor mutant alleles behave genetically as null. When rictor mutant alleles were placed in trans to a larger deficiency (Df(1)JA27) uncovering the gene, we observed size reduction similar to that observed with the alleles alone, suggesting that the two rictor deletions have little if any residual activity. *Student’s t-test < 0.001. (E) Expression of the sin1 mRNA coding region is severely impaired in the e03756 mutant. Total RNA was isolated from adult flies and analyzed by RT-PCR using primers complementary to regions 5’ and 3’ to the transposon insertion site. RP49 was used as control. (F) sin1 mutant allele behaves genetically as null. Homozygous sin1 mutants display similar wing size as the flies in which the sin1 allele was placed in trans to a larger deficiency (Df(2R)BSC11) uncovering the gene, suggesting that the sin1 mutant has little if any residual activity.
Supplemental Figure 2. Inhibition of AKT substrate phosphorylation by rictor and dAKT dsRNAs. In order to verify the data in Fig. 1G, we made use of dsRNAs directed against different parts of the rictor and AKT transcripts. S2 cells were treated for 4 days with double-stranded RNAs (Rictor2 and dAKT2). Cells were treated with insulin (10 mg/ml for 30 min) or left untreated, homogenized in sample buffer, boiled and analyzed by immunoblotting using antibodies against phosphorylated AKT target motif RxRxxS/T, AKT phospho-S505, or total AKT. The most prominent AKT substrate band at ~30 kDa is shown. Tubulin was used as loading control.
Supplemental Figure S3. Mutation of AKT HM suppresses hyperplasia caused by hyperactive PI3K signaling. Adult eyes containing AKT mutant clones were induced by eyeless promoter-driven expression FLP recombinase and rescued by AKT WT or S505A transgenes, as described in Fig. 2C. In this background AKT signaling was hyperactivated by expressing membrane-targeted PI3K (Dp110-CAAX) using GMR-GAL4. Lateral and dorsal views of adult fly heads are shown.
Supplemental Figure S4. Schematic representation of the PI3K/AKT pathway. The contribution of the individual pathway members in terms of viability and tissue growth regulation is displayed (red positive regulator, blue negative regulator). TORC2 acts as a rheostat, required for broadening the output range of AKT signaling at high levels of pathway activity, and therefore differs significantly from the essential core pathway members.
SUPPLEMENTAL REFERENCES
Jacinto, E., R. Loewith, A. Schmidt, S. Lin, M.A. Ruegg, A. Hall, and M.N. Hall. 2004. Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat Cell Biol 6: 1122-8.
Sarbassov, D.D., S.M. Ali, D.H. Kim, D.A. Guertin, R.R. Latek, H. Erdjument-Bromage, P. Tempst, and D.M. Sabatini. 2004. Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptor-independent pathway that regulates the cytoskeleton. Curr Biol 14: 1296-302.