Animals
Female C57BL/6 mice aged 6-8 weeks were purchased from the Academy ofMilitary Medical Science (Beijing, China). The animals were housed and fed in a specificpathogen-free animal facility at the Experimental Animal Center of Tianjin MedicalUniversity (Tianjin, China).The experiments were performed in accordance with the guidelines for animal care and wereapproved by the Animal Ethics Committee of Tianjin Medical University (Tianjin, China).
CD14+cell purification and DC differentiation and maturation
The fresh human buffy coats were obtained from the TianjinBloodCenter (Tianjin,China). The peripheral blood mononuclear cells (PBMCs) were isolated by centrifugation through Ficoll-Paque PLUS (Amersham Biosciences, Uppsala,Sweden) at 400×g for 30min and were washed 3 times with phosphate buffered saline (PBS). The CD14+ monocytes were separated from the PBMCs using a magnetic separation column in accordance with the manufacturer’s instructions (Miltenyi Biotech, Auburn, CA) and were washed thoroughly to eliminatethe unspecific binding of the cells to the beads. The purified CD14+ monocytes were analyzed on a FACSCalibur (Becton Dickinson, San Jose, CA, USA) to confirm the purity of the CD14+ cells (95%). Complete RPMI 1640 culture medium containing 100mM sodiumpyruvate, 200mM L-glutamine, 100 mg/ml kanamycin and 10% fetal bovine serum(FBS)(Gibco, InvitrogenAuckland,NZ)were used for the routine culture of the primarycells. For the DC differentiation, the purified CD14+ cells werecultured in the presence of 1,000 U/ml recombinant human granulocytemacrophage-colony stimulating factor (GM-CSF) and 1,000 U/ml interleukin-4 (IL-4)(Peprotech, Rocky Hill, USA). At the same time, the cells were treated with or without 0.008, 0.04, or 0.2 μM ZSTK474 (Haoyuan Chemexpress Co.,Ltd., Shanghai, China) for 5 days. For the DCmaturation, the iDCs with or without the ZSTK474 treatment were treated with 1 μg/ml LPS on day 5 and were incubated for an additional 2 days in the complete RPMI1640 medium.
Flow Cytometric Analysis of Apoptosis
Human DCs were cultured in complete RPMI 1640 culture medium containing 100mM sodiumpyruvate, 200mM L-glutamine, 100 mg/ml kanamycin and 10% fetal bovine serum(FBS)(Gibco, InvitrogenAuckland,NZ). Then 0.008, 0.04, or 0.2 μM ZSTK474 and LPS (1 μg/ml) which would stimulate the maturation of iDCs were added into the culture medium described above. After 48h, the apoptotic human iDCs and mDCs were detected by AnnexinⅤCell Apoptosis Analysis Kit (Sungene Biotech Co. Ltd). The cells were analyzed by FACS Calibur(Becton Dickinson, San Jose, CA, USA) and the FlowJo software(Tree Star, Ashland, OR) was used to analyze the acquired data.
Flow cytometry analysis
The cells were harvested on day 5 for the analysis of the human CD14+ monocyte-derived DCdifferentiation or on day 7 for the analysis of the maturation. The DCs were stained for the surface markers CD80,CD83, CD86, and HLA-DR using anti-human FITC-conjugated antibodies andwere stained simultaneously with PE-conjugated CD11c antibody (BD Biosciences, CA,USA). A fluorescenceactivated cell sorter (FACS, BD Calibur) was used for the analysis. The FACS data were analyzedusing the FlowJo software (Tree Star, Ashland, OR).
Endocytosis analysis of iDCs
The endocytosis was quantified as the cellular uptake of FITC-dextran (Sigma, St. Louis,USA). The iDCs were incubated in medium(100mM sodiumpyruvate, 200mM L-glutamine, 100 mg/ml kanamycin and 10% fetal bovine serum) containing FITC-dextran (0.1 mg/ml) and were treated withor without ZSTK474, at either 4°C as the negative control or at 37°Cas thepositive control for 30 min. The cells were washed and were analyzed on a FACS Calibur asdescribed above.
Mixed-lymphocyte reaction (MLR) assay
The CD4+ T cells were positively selected from the fresh PBMCs using anti-humanCD4-conjugated microbeads (Miltenyi Biotec, Auburn, CA). The purified CD4+ Tcells(95%) were resuspended in PBS (107 cells/ml,) and treated with 2μM CFSE(Invitrogen, Oregon, USA) for 30 min at 37°C. Then, cells were washed twice with complete RPMI 1640 medium to terminate the staining process. The LPS-activated mDCs with orwithout the ZSTK474 treatment were pretreated using mitomycin C (25μg/ml) beforecoculturing with the CD4+ T cells. The CFSE-labeled CD4+ cells and the pretreated DCs were addedto each well of a U-bottom microtiter plate (2×105 cells/well). Next, the mDCs were coculturedwith allogeneic CD4+ T cells at a ratio of 1:10, 1:20, and 1:40 for 4 days. Thecells were acquired using a FACS Calibur( Becton Dickinson, San Jose, CA,USA) and the data were analyzed usingthe FlowJo software.
Quantitative real-time PCR
The RNA was extracted using the TRIzol reagent(Invitrogen, Carlsbad, USA) in accordance with the manufacturer’sinstructions. After the RNA purification, the samples were treated with DNase toremove the contaminating genomic DNA. The reversetranscription was performed using random hexamers and M-MLV reverse transcriptase (Promega, Madison, USA). The other reagents were from Takara (Takara, Japan). The gene-specific primerswereintron-overstretching andsynthesized at BGI (Beijing,China). Forthe relative quantitative real-time PCR, the SYBR Greenmix (Takara, Japan) was used in accordance with the manufacturer’sinstructions. The reactions were performed in triplicate on an ABI PRISM 7500 Fast Real-Time PCR System (Applied Biosystems Inc., Foster City, CA, USA), and the generated products were analyzed using the ABI 7500 software (Version 2.0.5, Applied Biosystems Inc., Foster City, CA, USA). The primer pairs are listed below:
Human gene primers / Sense (5’-3’) / Anti-sense (5’-3’)IL-23p19 / GGACAACAGTCAGTTCTGCTT / CACAGGGCTATCAGGGAGC
IL-12p40 / ACAAAGGAGGCGAGGTTCTAA / CCCTTGGGGGTCAGAAGAG
IL-12p35 / CCTTGCACTTCTGAAGAGATTGA / ACAGGGCCATCATAAAAGAGGT
IL-6 / AAATTCGGTACATCCTCGACGG / GGAAGGTTCAGGTTGTTTTCTGC
TNF-α / GAGGCCAAGCCCTGGTATG / CGGGCCGATTGATCTCAGC
IFN-γ / CTCTTGGCTGTTACTGCCAGG / CTCCACACTCTTTTGGATGCT
GAPDH / ACCACAGTCCATGCCATCAC / TCCACCACCCTGTTGCTGTA
The geneexpression was normalized based on the GAPDH mRNA levels. The data are presented as the 2-△△Ctvalues and are representative of at least threeindependent experiments.
Western blot analysis
The DCs were lysed in buffer containing 10mMTris-buffer at pH 7.6, 1% TritonX-100, 1% phosphatase inhibitor cocktail and 1 mMPMSF. The lysates were boiledin sodium dodecyl sulfate(SDS) sample buffer and were subjected to SDS-PAGE. The rabbitpolyclonal antibodies against GAPDH, Akt, phosphorylated Akt (phosphorylatedon residue Ser-473) and phosphorylated glycogen synthase kinase3 β (GSK-3β, phosphorylated residue Ser-9)were purchasedfrom Cell Signaling Technology (Beverly, MA,USA) and werediluted 1:1,000. The horseradish peroxidase-conjugated goat anti-rabbit immunoglobulinG (SantaCruzBiotechnology, CA, USA) was used as the secondaryantibody. The immunoreactive bands were identified using the ECLWestern Blotting Detection System (Millipore Corporation,Billerica, MA, USA).