BCL2 antagonist killer 1 (BAK1) polymorphisms influence the risk of developing autoimmune rheumatic diseases in women
Supplementary Information
Angélica M. Delgado-Vega1,2, John Castiblanco2, Luis M. Gómez2, Lina-Marcela Diaz-Gallo2,
Adriana Rojas-Villarraga1,2, Juan-Manuel Anaya1,2
1Center for Autoimmune Disease Research (CREA), School of Medicine, Rosario University, Bogotá, Colombia.
2Cellular Biology and Immunogenetics Unit, Corporación para Investigaciones Biológicas, Medellín, Colombia.
This supplementary material contains:
- PCR-SSCP protocol.
- TaqMan® real-time protocol.
- Supplementary tables S1-S7.
- PCR-SSCP protocol.
Primers located within the intronic sequences were used to amplify the entire coding sequence of BAK1 (exons 2 to 6) in five fragments of <262 bp each including the intron/exon boundaries (supplementary table S4).[1] The PCR amplification of each exon was done under standard conditions in a 20 μl reaction mixture containing 0.5 μl of template DNA, 200 nM of each primer, 0.2 mM of each deoxynucleotide triphosphate, 1.5 mM MgCl2, 0.4 units of Taq DNA polymerase (Fermentas Inc., Hanover, USA), and 2 μl of 10X PCR buffer. PCR reactions were carried out for 5 min at 95°C followed by 40 cycles of 1 min at 95°C, 1 min at 55°C and 1 min at 72°C. Fifteen μl of PCR products were diluted with 10 μl of denaturant-loading buffer (90% formamide, 20 nM EDTA, 0.05% xylene cyanol and 0.05% bromophenol blue) and denatured at 95°C for 2 min.PCR products were then subjected to electrophoresis on 15% polyacrylamide gels (acrylamide:bisacrylamide ratio 29:1) at 37°C without glycerol under a constant current of 150V for 18 hr, using 1X Tris-glicine buffer in a PROTEAN II xi Cell (BioRAD). DNA fragments were visualized by staining with silver nitrate. Sense and anti-sense strands from DNA samples showing mobility-shifted bands were directly sequenced with an ABI Prism 377 genetic analyzer (Macrogen, Seoul, Korea) using the same primers. In addition, 10% of the DNA samples were randomly selected for sequencing.
- TaqMan ® real time protocol.
Primer pairs and allele-specific TaqMan® probes were designed by Custom TaqMan® SNP Genotyping Assays (Applied Biosystems, Foster City, CA, USA) according to dbSNP build 125 (supplementary table S5). The PCR reaction was carried out in a total volume of 12.5 μl as follows: initial activation of AmpliTaq Gold DNA polymerase at 95°C for 10 min, followed by 40 cycles of denaturation at 92°C for 15 seconds, and annealing/extension at 60°C for 1 min. After PCR, genotype for each SNP was assigned by measuring allele-specific fluorescence in an iCycler iQ Detection System (Bio-Rad, Hercules, California, USA).
Table S1 Clinical manifestations in patients with primary Sjögren’s syndrome
Clinical manifestation / Frequency / Valid Percent %Mean age ±S.D. = 52.0 ± 14.3 years
Extraglandular manifestation as first symptom / 33 / 34.74
Vascular-inflammatory / 68 / 71.58
Musculoskeletal involvement / 66 / 69.47
Internal organ involvement / 17 / 18.28
Raynaud´s phenomenon / 15 / 15.79
Cutaneous inflammation / 14 / 14.74
Lymphopenia / 10 / 11.11
Autoantibodies
- Antinuclear antibodies
- Anti-SSA/Ro
- Rheumatoid Factor
- Anti-SSB/La
All patients met the international classification criteria for disease [2] and their clinical and immunological characteristics were similar to those previously reported [3]
Table S2 Clinical manifestations in patients with systemic lupus erythematosus
Clinical manifestation / Frequency / Valid Percent %Mean age ± S.D. = 35.2 ± 12.2 years
Cutaneous involvement / 164 / 89.13
Renal involvement / 91 / 52.91
Neurological involvement / 56 / 30.60
Raynaud’s phenomenon / 32 / 17.39
Pulmonary involvement / 32 / 17.39
Antiphospholipid Syndrome / 20 / 10.87
Autoantibodies
Antinuclear antibodies / 166 / 97.08
Anti-extractable nuclear antigen antibodies / 103 / 63.98
Anti-dsDNA / 100 / 59.88
Anti-SSA/Ro / 64 / 40.25
Anti-RNP / 61 / 38.36
Anti-Sm / 52 / 32.5
Anticardiolipin IgG / 34 / 26.77
Anticardiolipin IgM / 31 / 24.6
Lupus anticoagulant / 23 / 20.35
Anti-SSB/La / 29 / 18.24
All patients met the international classification criteria for disease [4] and their clinical and immunological characteristics were similar to those previously reported [5-7]
Table S3Clinical manifestations in patients with rheumatoid arthritis
Clinical manifestation / Frequency / Valid Percent %Mean age ±S.D.= 51.7 ± 11.6 years
Articular involvement at onset
- Monoarticular
- Oligoarticular
- Polyarticular
Extra-articular manifestations / 69 / 53.49
Rheumatoid factor / 71 / 82.56
HLA-DR4 / 50 / 65.79
All patients met the international classification criteria for disease [8] and their clinical and immunological characteristics were similar to those previously reported [9, 10]
Table S4 Primer sequences for analysis of BAK1 gene [1].
Exon / 5’ sense primer sequence / 3’ antisense primer sequence / Fragment size (bp)2 / TGGTTATGGGATGGGTGAGG / CTGCTTTTTCTCGCCCTTCC / 165
3 / TGCCTCCCTGAAGATGTCCT / TGACTCCCAGCTTTGATCCT / 204
4 / GGCAGGGTATGGTATGGTTG / TCCCGACTGCCTGGTTACTG / 262
5 / CCAACAGCAGGGAGGACATT / CAATGCTATGGGATGCTCTG / 247
6 / GCAAGGGAACAGAGAAGGCA / TGACCACCTTGTTTCTCCCG / 210
Table S5 Primers and probes designed for allelic discrimination by real-time PCR
Assay ID / Sense Primer Sequence (S)Antisense Primer Sequence (AS) / Reporter 1 Sequence
Reporter 1 dye: VIC® / Reporter 2 Sequence
Reporter 2 dye: FAM™ / Design
Strand
rs210135 / S: ACTACAGGGCTTAGGACTTGGTT
AS: CCCTCCAGATGAACTCCCTACTC / CTTTTCCCTGATATAACA / TTTCCCTGAAATAACA / R
rs513349 / S: CCCTTCCTCGGGTTCCTATATCT
AS: CTGCCGGGAGAAACAAGGT / CACAGAGAGGCTAGCAGA / CAGAGAGGCTGGCAGA / R
rs210138 / S: GCCCTTAGTCTCCTGGTTTGTAAAA
AS: CCTAACTCTGGTGGTAGCAATGG / AAAATATGCTTAGATTAGTGTCCA / ATGCTTAGATCAGTGTCCA / F
A115D / S: GCAGAGAATGCCTATGAGTACTTCA
AS: GGCAGGGAGGTGGCT / CCTGGTGGCAATCT / ACCTGGTGTCAATCT / R
rs561276 / S: CAGAGTTCCAGACCATGTTGCA
AS: GTGGCAATCTTGGTGAAGTACTCAT / AGCCCACGGCAGAG / CAGCCCACAGCAGAG / F
D83E / S: CATGCCTCCTGCTCCTACAG
AS: GGTCTGGAACTCTGAGTCATAGC / TTGATGTCGTCCCCGATGA / TTGATGTCCTCCCCGATGA / R
rs4987115 / S: ACTCCCAGCTTTGATCCTCAGA
AS: CTGCGGAAAACCTCCTCTGT / CCTGGGCTACCTGC / TCCTGGACTACCTGC / R
rs5745582 / S: CAAACTGAAAGTGAAACAGCTGACA
AS: GCCCCAACCTGCTGTGA / AGGAAACACTCGCCCTGA / AGGAAACACTCACCCTGA / F
Nucleotides hybridizing with the polymorphic site are highlighted in the sequence. R: reverse, F: forward.
Table S6Linkage disequilibrium between BAK1 SNPs and HLA-DRB1 and HLA-DQB1 alleles
Patients / ControlsHLA-DRB1 allele / rs513349 allele / r2 / HLA-DRB1 allele / rs513349 allele / r2
*0707 / G / 0.0000 / *1425 / G / 0.0200
*1020 / G / 0.0100 / *11 / G / 0.0100
*1010 / G / 0.0000 / *0422 / G / 0.0100
*0103 / G / 0.0000 / *0408 / G / 0.0200
*1602 / G / 0.0100 / *0701 / G / 0.0100
*0824 / G / 0.0000 / *1404 / G / 0.0100
*1137 / G / 0.0000 / *12 / G / 0.0100
*16 / G / 0.0000 / *0306 / G / 0.0200
*15 / G / 0.0100 / *14 / G / 0.0100
*11 / G / 0.0300 / *0301 / G / 0.0200
*01 / G / 0.0000 / *0802 / G / 0.0300
*13 / G / 0.0100 / *0402 / G / 0.0000
*08 / G / 0.0200 / *1503 / G / 0.0100
*03 / G / 0.0000 / *1401 / G / 0.0100
*07 / G / 0.0000 / *1601 / G / 0.0100
*14 / G / 0.0100 / *0407 / G / 0.0300
*0302 / G / 0.0100 / *0101 / G / 0.0400
*04 / G / 0.0000 / *0404 / G / 0.0100
*0301 / G / 0.0100 / *0410 / G / 0.0300
*0102 / G / 0.0100 / *07 / G / 0.0100
*0401 / G / 0.0100 / *1402 / G / 0.0000
*12 / G / 0.0000 / *1501 / G / 0.0400
*0306 / G / 0.0000 / *1602 / G / 0.0200
*0402 / G / 0.0100 / *13 / G / 0.0000
*0101 / G / 0.0200 / *0304 / G / 0.0100
*0314 / G / 0.0100 / *1421 / G / 0.0100
*0403 / G / 0.0000 / *03 / G / 0.0100
*0407 / G / 0.0000 / *0901 / G / 0.0300
*1116 / G / 0.0100 / *1510 / G / 0.0100
*0419 / G / 0.0000 / *0103 / G / 0.0200
*1403 / G / 0.0000 / *0804 / G / 0.0100
*1503 / G / 0.0000 / *1001 / G / 0.0100
*0404 / G / 0.0100 / *0102 / G / 0.0000
*0804 / G / 0.0000 / *1502 / G / 0.0100
*0405 / G / 0.0100 / *0411 / G / 0.0100
*0901 / G / 0.0100 / *0403 / G / 0.0000
*0441 / G / 0.0100 / *1101 / G / 0.0100
*0805 / G / 0.0000 / *0305 / G / 0.0100
*0408 / G / 0.0000 / *0801 / G / 0.0100
*0701 / G / 0.0100 / *1303 / G / 0.0100
*1309 / G / 0.0000 / *1301 / G / 0.0100
*1412 / G / 0.0000 / *1302 / G / 0.0100
*1501 / G / 0.0100 / *0706 / G / 0.0100
*1101 / G / 0.0000 / *0420 / G / 0.0100
*1201 / G / 0.0000
*0320 / G / 0.0000
*1303 / G / 0.0000
*0303 / G / 0.0000
*1441 / G / 0.0000
*0317 / G / 0.0000
*0801 / G / 0.0000
*1001 / G / 0.0000
*0410 / G / 0.0000
*1132 / G / 0.0000
*1402 / G / 0.0100
*1401 / G / 0.0000
*1327 / G / 0.0000
*0448 / G / 0.0100
*1102 / G / 0.0000
*0802 / G / 0.0000
*0432 / G / 0.0200
*0415 / G / 0.0000
*0309 / G / 0.0100
*0424 / G / 0.0000
*0418 / G / 0.0000
*1212 / G / 0.0000
*1204 / G / 0.0000
*1320 / G / 0.0000
*1404 / G / 0.0000
HLA-DRB1 allele / rs5745582 allele / r2 / HLA-DRB1 allele / rs5745582 allele / r2
*1020 / A / 0.0000 / *11 / A / 0.0400
*0707 / A / 0.0000 / *1425 / A / 0.0100
*1010 / A / 0.0000 / *0408 / A / 0.0100
*0103 / A / 0.0000 / *0422 / A / 0.0000
*1602 / A / 0.0300 / *0701 / A / 0.0000
*1137 / A / 0.0000 / *12 / A / 0.0000
*0824 / A / 0.0000 / *1404 / A / 0.0200
*15 / A / 0.0100 / *0306 / A / 0.0100
*16 / A / 0.0000 / *14 / A / 0.0300
*01 / A / 0.0000 / *0301 / A / 0.0100
*11 / A / 0.0000 / *0802 / A / 0.0000
*13 / A / 0.0200 / *0402 / A / 0.0000
*08 / A / 0.0000 / *1503 / A / 0.0000
*03 / A / 0.0100 / *1401 / A / 0.0200
*07 / A / 0.0000 / *1601 / A / 0.0200
*0302 / A / 0.0300 / *0407 / A / 0.0200
*14 / A / 0.0000 / *0101 / A / 0.0100
*04 / A / 0.0000 / *0410 / A / 0.0300
*0301 / A / 0.0100 / *0404 / A / 0.0100
*0102 / A / 0.0100 / *07 / A / 0.0300
*0401 / A / 0.0100 / *1402 / A / 0.0000
*12 / A / 0.0000 / *1501 / A / 0.0100
*0306 / A / 0.0100 / *1602 / A / 0.0100
*0402 / A / 0.0100 / *13 / A / 0.0000
*0314 / A / 0.0000 / *0304 / A / 0.0000
*0101 / A / 0.0200 / *1421 / A / 0.0200
*0403 / A / 0.0000 / *0901 / A / 0.0100
*0407 / A / 0.0000 / *03 / A / 0.0100
*1116 / A / 0.0000 / *0103 / A / 0.0100
*0419 / A / 0.0000 / *1510 / A / 0.0200
*1403 / A / 0.0100 / *0804 / A / 0.0000
*1503 / A / 0.0000 / *01001 / A / 0.0200
*0404 / A / 0.0000 / *0102 / A / 0.0200
*0804 / A / 0.0000 / *1502 / A / 0.0000
*0405 / A / 0.0000 / *0411 / A / 0.0000
*0901 / A / 0.0000 / *0403 / A / 0.0100
*0441 / A / 0.0000 / *1101 / A / 0.0000
*0805 / A / 0.0000 / *0305 / A / 0.0200
*0408 / A / 0.0000 / *0801 / A / 0.0200
*0701 / A / 0.0000 / *1303 / A / 0.0200
*1309 / A / 0.0000 / *1301 / A / 0.0000
*1412 / A / 0.0000 / *1302 / A / 0.0000
*1501 / A / 0.0100 / *0706 / A / 0.0200
*1101 / A / 0.0000 / *0420 / A / 0.0000
*1201 / A / 0.0000
*0320 / A / 0.0000
*1303 / A / 0.0000
*0303 / A / 0.0000
*0317 / A / 0.0000
*1441 / A / 0.0000
*0801 / A / 0.0100
*1001 / A / 0.0000
*0410 / A / 0.0000
*1132 / A / 0.0000
*1402 / A / 0.0200
*1401 / A / 0.0000
*1327 / A / 0.0000
*0448 / A / 0.0000
*1102 / A / 0.0000
*0802 / A / 0.0000
*0432 / A / 0.0100
*0415 / A / 0.0000
*0309 / A / 0.0000
*0424 / A / 0.0000
*0418 / A / 0.0000
*1212 / A / 0.0000
*1204 / A / 0.0000
*1320 / A / 0.0000
*1404 / A / 0.0000
HLA-DQB1 allele / rs513349 allele / r2 / HLA-DQB1 allele / rs513349 allele / r2
*0501 / G / 0.0483 / *0303 / G / 0.0235
*0201 / G / 0.0235 / *0302 / G / 0.0018
*0302 / G / 0.0002 / *0201 / G / 0.0002
*0301 / G / 0.0119 / *06 / G / 0.0009
*0402 / G / 0.0191 / *0304 / G / 0.0059
*0603 / G / 0.0108 / *0202 / G / 0.0409
*0202 / G / 0.0164 / *0402 / G / 0.0024
*0303 / G / 0.0313 / *0602 / G / 0.0344
*0602 / G / 0.0036 / *0503 / G / 0.0171
*06 / G / 0.0007 / *0501 / G / 0.0046
*0601 / G / 0.0008 / *0301 / G / 0.0204
*0503 / G / 0.0136 / *0603 / G / 0.0461
*03 / G / 0.0087 / *0502 / G / 0.0119
*0604 / G / 0.0054 / *0601 / G / 0.0050
*0502 / G / 0.0176 / *0604 / G / 0.0272
*0401 / G / 0.0096 / *0609 / G / 0.0085
*0305 / G / 0.0009 / *0509 / G / 0.0028
*0607 / G / 0.0027 / *0312 / G / 0.0029
*0304 / G / 0.0027 / 311 / G / 0.0028
HLA-DQB1 allele / rs5745582 allele / r2 / HLA-DQB1 allele / rs5745582 allele / r2
*0501 / A / 0.0283 / *0303 / A / 0.0000
*0201 / A / 0.0235 / *0302 / A / 0.0042
*0302 / A / 0.0206 / *0201 / A / 0.0066
*0301 / A / 0.0097 / *06 / A / 0.0074
*0402 / A / 0.0351 / *0304 / A / 0.0020
*0603 / A / 0.0133 / *0202 / A / 0.0095
*0202 / A / 0.0164 / *0402 / A / 0.0095
*0303 / A / 0.0313 / *0602 / A / 0.0016
*06 / A / 0.0027 / *0503 / A / 0.0297
*0602 / A / 0.0000 / *0501 / A / 0.0289
*0601 / A / 0.0007 / *0603 / A / 0.0231
*0503 / A / 0.0064 / *0301 / A / 0.0774
*03 / A / 0.0027 / *0502 / A / 0.0041
*0604 / A / 0.0054 / *0601 / A / 0.0052
*0502 / A / 0.0054 / *0604 / A / 0.0094
*0401 / A / 0.0415 / *0609 / A / 0.0094
*0305 / A / 0.0054 / *0509 / A / 0.0010
*0607 / A / 0.0087 / *0312 / A / 0.0081
*0304 / A / 0.0087 / *0311 / A / 0.0010
Table S7 Case-only test for interaction between BAK1 and HLA loci
rs513349 (A) / rs513349 (G) / p-value / rs5745582 (G) / rs5745582 (A) / p-valueRA / DR4 - / 13 / 48 / 31 / 30
DR4 + / 10 / 59 / 0.36 / 33 / 36 / 0.86
SLE and pSS / DR3 - / 2 / 47 / 19 / 30
DR3 + / 3 / 18 / 0.15 / 8 / 13 / 1
DR2 - / 5 / 58 / 26 / 37
DR2 + / 0 / 7 / 1 / 1 / 6 / 0.24
DQ2 - / 4 / 27 / 11 / 20
DQ2 + / 1 / 15 / 0.65 / 10 / 6 / 0.12
All AIRD / DR4 - / 18 / 94 / 51 / 61
DR4 + / 10 / 78 / 0.41 / 40 / 48 / 1
DR3 - / 21 / 139 / 73 / 87
DR3 + / 7 / 33 / 0.45 / 18 / 22 / 1
DR2 - / 27 / 151 / 83 / 95
DR2 + / 1 / 21 / 0.32 / 8 / 14 / 0.49
DQ2 - / 12 / 66 / 33 / 45
DQ2 + / 10 / 50 / 1 / 32 / 28 / 0.23
Supplementary References
[1]Kondo S, Shinomura Y, Miyazaki Y, Kiyohara T, Tsutsui S, Kitamura S, et al. Mutations of the bak gene in human gastric and colorectal cancers. Cancer Res 2000;60:4328-30.
[2]Vitali C, Bombardieri S, Jonsson R, Moutsopoulos HM, Alexander EL, Carsons SE, et al. Classification criteria for Sjogren's syndrome: a revised version of the European criteria proposed by the American-European Consensus Group. Ann Rheum Dis 2002;61:554-8.
[3]Anaya JM, Correa PA, Mantilla RD, Arcos-Burgos M. TAP, HLA-DQB1, and HLA-DRB1 polymorphism in Colombian patients with primary Sjogren's syndrome. Semin Arthritis Rheum 2002;31:396-405.
[4]Hochberg MC. Updating the American College of Rheumatology revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 1997;40:1725.
[5]Gomez D, Correa PA, Gomez LM, Cadena J, Molina JF, Anaya JM. Th1/Th2 cytokines in patients with systemic lupus erythematosus: is tumor necrosis factor alpha protective? Semin Arthritis Rheum 2004;33:404-13.
[6]Anaya JM, Uribe M, Perez A, Sanchez JF, Pinto LF, Molina JF, et al. Clinical and immunological factors associated with lupus nephritis in patients from northwestern Colombia. Biomedica 2003;23:293-300.
[7]Correa PA, Molina JF, Pinto LF, Arcos-Burgos M, Herrera M, Anaya JM. TAP1 and TAP2 polymorphisms analysis in northwestern Colombian patients with systemic lupus erythematosus. Ann Rheum Dis 2003;62:363-5.
[8]ArnettFC, Edworthy SM, Bloch DA, McShane DJ, Fries JF, Cooper NS, et al. The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum 1988;31:315-24.
[9]Anaya JM, Correa PA, Mantilla RD, Jimenez F, Kuffner T, McNicholl JM. Rheumatoid arthritis in African Colombians from Quibdo. Semin Arthritis Rheum 2001;31:191-8.
[10]Anaya JM, Correa PA, Mantilla RD, Arcos-Burgos M. Rheumatoid arthritis association in Colombian population is restricted to HLA-DRB1*04 QRRAA alleles. Genes Immun 2002;3:56-8.