Appendix S1: Isolation and characterisation of DNA microsatellite loci in Xantusia vigilis
We isolated, developed, and simultaneously amplified eight microsatellite loci for use in determining relatedness and parentage in Xantusia vigilis. To create an enriched library of microsatellite loci, we extracted DNA from four individuals in a single population on the north side of the aqueduct using a standard chloroform protocol (Pogson et al. 1995). The source of DNA for all extractions was tail tips stored in absolute ethanol. We then screened this genomic DNA for di- and tetranucleotide (CA and AAAG) repeats according to the protocol described in Gow et al. (2006). From this screen, 96 prospective clones were sequenced by Macrogen ( on an ABI (Applied Biosystems, Inc) 3730xl genetic analyzer with BigDye Terminator v3.1 chemistry (ABI) and the vector primer M13F. We identified 37 unique microsatellite motifs (GenBank accession numbers FJ197161-FJ197197) that had adequately sized flanking regions for which we could design primers (Primer3, Rozen and Skaletsky 1998). Primers were synthesised by ABI using the G5 dye-set (FAM, VIC, NED and PET dyes, Table 1). We screened 18 of these loci for those that both amplified reliably and had suitable polymorphism to produce low identity non-exclusion probabilities.
We then amplified each locus individually in eight lizards using 100-150ng of genomic DNA, 1.5mM MgCl2, 0.1mM of each dNTP, 0.26µM of each primer, and 0.25U of GoTaq FlexiDNA polymerase with 2μl of the associated colorless 5x buffer (Promega Corporation) in 10µl final reaction volume. We used PCR cycling conditions of a two minute denature step at 95°C followed by 30 cycles of 30 seconds each at 95°C, 56°C, and 72°C and a final extension of five minutes at 72°C in an ABI 9600 thermal cycler. We then ran the samples on an ABI 3730xl genetic analyser (UC Berkeley DNA Sequencing Facility) with the internal size standard LIZ 500 (ABI) and used GeneMapper 4.0 (ABI) to analyse the chromatograms.
To create a multiplex, we used the eight loci that amplified most reliably under these standard conditions and showed variation across the eight individuals. We amplified these loci simultaneously with the Qiagen Multiplex PCR Kit using 100-150ng of template DNA according to manufacturer's instructions. The final reaction volume was 10µl instead of the suggested 50µl. We varied primer concentrations by locus from 0.1-0.3µM (Table S1).
To assess variation across the Llano population, we extracted genomic DNA from 463 X. vigilis using the Chelex protocol in Estoup et al. (1996) and amplified and genotyped each using the multiplex and analysis protocols described above. We used Cervus (Kalinowski et al. 2007) to calculate allelic diversity and heterozygosity and genepop (Raymond and Rousset 1995) to test for departures from Hardy-Weinberg equilibrium and linkage disequilibrium between loci.
All eight loci were polymorphic, with a range from three to 33 alleles per locus and averaging 19.3 across all loci (Table S1). Mean expected heterozygosity (He) was 0.79, with locus-specific values ranging from 0.39 to 0.94. We found no evidence of linkage disequilibrium between any pair of loci, and seven loci showed no significant departure from Hardy-Weinberg equilibrium after Bonferroni correction and amplified successfully in all samples. The one locus that did show deviation (AAEA) had an overabundance of homozygotes and failed to amplify in 158 (34%) samples, suggesting a high frequency (0.36) of null alleles. We thus excluded this locus from our further estimates of relatedness.
1
Table S1. Characteristics of eight microsatellite loci in Xantusia vigilis (N = 463).
Locus / Repeat Motif / Primer Sequence (5′-3′)(F=dye-forward, R=reverse) / Primer (μM) / Size Range (bp) / N / Ho / He / GenBank
Accession #
Xv-AAEA* / (AAAG)16 / F: NED-AATGGTCGCCTGTTCCATAG
R: AGCAATGTTGCTCAATGCAC / 0.2 / 231-276 / 13 / 0.395 / 0.833 / FJ197161
Xv-BAB / (AG)31 / F: PET-TATGGGGGTGATAGCTTTGC
R: TCCTGATGAAGACAGAAAATGG / 0.2 / 234-302 / 32 / 0.929 / 0.938 / FJ197162
Xv-CHEL / (AAAG)19 / F: VIC-ATGTTTTCCTGTCCCAAAGG
R: GGCAAGCTATCCTCTGCTTG / 0.3 / 237-321 / 30 / 0.829 / 0.904 / FJ197163
Xv-GLA / (AAAG)17 / F: FAM-TTGCCTGTCCCAAAAGTCTC
R: CCTGACTGGAAGGAGCTCAG / 0.3 / 257-319 / 15 / 0.883 / 0.890 / FJ197164
Xv-HIS / (CT)9(CA)8 / F: PET-TAGCTCCACTGGACCCTCTC
R: GTGGAGGGCTGCTCAATATG / 0.1 / 214-218 / 3 / 0.350 / 0.386 / FJ197165
Xv-MERC / (AG)29 / F: FAM-CACAGTGGGACATTCTGCTG
R: GGGCTATCCCACATTGGAG / 0.1 / 117-199 / 33 / 0.886 / 0.901 / FJ197166
Xv-OMA / (AAAG)16 / F: FAM-CTGCCATCCATCACAACATC
R: GATCTGACACAGTCAAAGACAGC / 0.1 / 211-272 / 20 / 0.890 / 0.897 / FJ197167
Xv-SNST / (CA)14 / F: VIC-ACCCTCCTCTTGCATTTGTG
R: CGAGGAAGTGGAGAAAGTGG / 0.3 / 127-151 / 8 / 0.610 / 0.587 / FJ197168
Note: We simultaneously amplified these loci with the varying primer concentrations (µM) given by using the Qiagen PCR Multiplex Kit under recommended conditions (final reaction volume of 10µl and annealing temperature of 60°C). We give the locus name, repeat motif, primer sequences, and GenBank accession numbers for each sequenced clone alongside allele size range (bp), number of alleles (N), and observed (Ho) and expected (He) heterozygosities. We also submitted sequences for another 29 candidate clones to GenBank (accession numbers FJ197169-FJ197197).
*Locus with significant deviation (P < 0.05) from Hardy-Weinberg equilibrium after Bonferroni correction.
1
Appendix S1 Bibliography
Estoup, A., Largiader, C. R., Perrot, E. & Chourrout, D. 1996 Rapid one-tube extraction for reliable PCR detection of fish polymorphic markers and transgenes. Molecular Marine Biotechnology20, 295-298.
Kalinowski, S. T., Taper, M. L. & Marshall, T. C. 2007 Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology16, 1099-106.
Pogson, G. H., Mesa, K. A. & Boutilier, R. G. 1995 Genetic population structure and gene flow in the Atlantic cod Gadus morhua: a comparison of allozyme and nuclear RFLP loci. Genetics139, 375-85.
Raymond, M. & Rousset, F. 1995 Genepop (Version-1.2): Population genetics software for exact tests and ecumenicism. Journal of Heredity86, 248-249.
Rozen, R. & Skaletsky, H. 1998 primer3. Available from URL:
1