Additional file 1 Overview of the quantitative PCR assays

qPCR assay / Reference / Primers sequence 5’ – 3’ / Target gene / Cycling conditions / Primer
concentration
Atopobium vaginae / [1] / AV-F: CCCTATCCGCTCCTGATACC
AV-R: CCAAATATCTGCGCATTTCA / 16S rRNA / 10 min 95 °C, 40 (15s 95 °C, 20s 64 °C, 25s 72 °C) / 700 nM
700 nM
Gardnerella vaginalis / [2] / F-GV1: TTACTGGTGTATCACTGTAAGG
R-GV3: CCGTCACAGGCTGAACAGT / 16S rRNA / 10 min 95 °C, 40 (45s 95 °C, 45s 55 °C, 45s 72 °C) / 1250 nM
625 nM
Candida albicans / [3] / CA_rRNA_f: TTTGCTTGAAAGACGGTA*
CA_rRNA_r: TTGAAGATATACGTGGTGG* / ITS-1 / 10 min 95 °C, 45 (15s 95 °C, 60s 60 °C) / 250 nM
250 nM
Prevotella bivia / [4] / PBsulF: ACGTTTGGGCAAAGCTCCTTGTCT
PBsulR: GCGTGTACGCCAGTTGCAAGA / mucin-desulfating sulfatase / 1 min 95 °C, 40 (15s 94 °C, 40s 58 °C, 30s 72 °C) / 200 nM
200 nM
Escherichia coli / [5] / EcoliFW: CAACGAACTGAACTGGCAGA
EcoliRV: CATTACGCTGCGATGGAT / uidA / 2 min 50 °C, 10 min 95 °C, 40 (15s 95 °C, 60s 60 °C) / 300 nM
300 nM
Lactobacillus genus / [2] / LBF:ATGGAAGAACACCAGTGGCG
LBR: CAGCACTGAGAGGCGGAAAC / 16S rRNA / 15 min 95 °C, 37 (15s 95 °C, 45s 50 °C, 45s 72 °C) / 150 nM
150 nM
Lactobacillus crispatus / [6] / LcrisF: AGCGAGCGGAACTAACAGATTTACLcrisR : AGCTGATCATGCGATCTGCTT / 16S rRNA / 15 min, 95 °C, 40 (15s 95 °C, 60s 60 °C, 20s 72 °C) / 100 nM
100 nM
Lactobacillus gasseri / [7] / LgassF: AGCGAGCTTGCCTAGATGAATTTGLgassR:TCTTTTAAACTCTAGACATGCGTC / 16S rRNA / 15 min 95 °C, 40 (15s 95 °C, 60s 57 °C, 60s 65 °C) / 200 nM
200 nM
Lactobacillus iners / [8] / InersFw: GTCTGCCTTGAAGATCGG
InersRev: ACAGTTGATAGGCATCATC / 16S rRNA / 15 min 95 °C, 35 (15s 95 °C, 55s 60 °C, 60s 65 °C) / 200 nM
200 nM
Lactobacillus jensenii / [7] / LjensF:AAGTCGAGCGAGCTTGCCTATAGA
LjensR: CTTCTTTCATGCGAAAGTAGC / 16S rRNA / 15 min 95 °C, 40 (15s 95 °C, 55s 60 °C, 60s 72 °C) / 300 nM
300 nM
Lactobacillus vaginalis / [9] / LV16s_23s_F:GCCTAACCATTTGGAGGG
LV16s_23s_R3: CGATGTGTAGGTTTCCG / 16S-23S rRNA / 15 min 95 °C, 37 (15s 95 °C, 30s 56 °C, 30s 72 °C) / 200 nM
200 nM

*: adapted from reference 3 by Guiver et al.

Reference List

1. Menard JP, Fenollar F, Raoult D, Boubli L, Bretelle F. Self-collected vaginal swabs for the quantitative real-time polymerase chain reaction assay of Atopobium vaginae and Gardnerella vaginalis and the diagnosis of bacterial vaginosis. Eur J Clin Microbiol Infect Dis 2011.

2. Zariffard MR, Saifuddin M, Sha BE, Spear GT. Detection of bacterial vaginosis-related organisms by real-time PCR for Lactobacilli, Gardnerella vaginalis and Mycoplasma hominis. FEMS Immunol Med Microbiol 2002; 34(4):277-281.

3. Guiver M, Levi K, Oppenheim BA. Rapid identification of candida species by TaqMan PCR. J Clin Pathol 2001; 54(5):362-366.

4. Lopes dos Santos Santiago G, Tency I, Verstraelen H, Verhelst R, Trog M, Temmerman M, et al.Longitudinal qPCR study of the dynamics of L. crispatus, L. iners, A. vaginae, (sialidase positive) G. vaginalis, and P. bivia in the vagina. PLoS One 2012; 7(9):e45281.

5. Chern EC, Siefring S, Paar J, Doolittle M, Haugland RA. Comparison of quantitative PCR assays for Escherichia coli targeting ribosomal RNA and single copy genes. Lett Appl Microbiol 2011; 52(3):298-306.

6. Byun R, Nadkarni MA, Chhour KL, Martin FE, Jacques NA, Hunter N. Quantitative analysis of diverse Lactobacillus species present in advanced dental caries. J Clin Microbiol 2004; 42(7):3128-3136.

7. Tamrakar R, Yamada T, Furuta I, Cho K, Morikawa M, Yamada H, et al. Association between Lactobacillus species and bacterial vaginosis-related bacteria, and bacterial vaginosis scores in pregnant Japanese women. BMC Infect Dis 2007; 7:128.

8. De Backer E, Verhelst R, Verstraelen H, Alqumber MA, Burton JP, Tagg JR, et al.Quantitative determination by real-time PCR of four vaginal Lactobacillus species, Gardnerella vaginalis and Atopobium vaginae indicates an inverse relationship between L. gasseri and L. iners. BMC Microbiol 2007; 7(1):115.

9. Jespers V, Menten J, Smet H, Poradosu S, Abdellati S, Verhelst R, et al.Quantification of bacterial species of the vaginal microbiome in different groups of women, using nucleic acid amplification tests. BMC Microbiol 2012; 12:83.