Series of Selected Papers from Chun-Tsung Scholars,Peking University (2002)
A Research on Arginine-Rich Peptides Conjugated OligonucleotideTargeting to Telomerase
Yuefeng Peng , Changpo Chen , Lihe Zhang
National Research Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences and School of Chemistry & molecule engineering
Abstract: Antisense oligonucleotide is a kind of important molecular biological research tool and potent therapeutics. However, many classes of oligonucletides are polyanions and can not pass through cell membrane. It was reported that arginine-rich peptide such HIV Tat derived peptide has transmembrane function. Telomerase is a new target of anticancer therapy. An on-resin fragment coupling method for the peptide oligonucleotide conjugation is developed and is applied to the assembly of arginine-rich peptide oligonucleotide conjugate. This method avoids the precipitation occurred in the solution phase fragement coupling of basic peptide and oligonucleotide. R9C，R6C and TAT conjugated ODNs targeting to telomerase are synthesized with the on-resin method. The transmembrane activity of R9Cconjugated oligonucleotide was investigated using confocal fluorescence microscopy.
key words: peptide, oligonucleotide, peptide-conjugated antisense oligonucleotide, telomerase
INTRODUCTION
With the achievement of HGP(human genome project) andthe development of functional genomics, antisense drugs and antisense technology find their way in the new drug research and molecular biological science. For the therapeuticapplication, the problem of the permeability to the cell membrane and its instability in cells limit the biological activity of the antisense oligonucleotide. Scientists have tried to find some ways to increase oligonucleotide’s ability of penetrating cell and nucleous membrane. Recently it was demonstrated that the conjugate of transduction peptide with oligonucleotide can both increase the stability and the antisense activity of the oligonucleotide dramatically. The most attractive peptide sequence is the basic fragment of HIV Tat protein which has a arginine-rich sequence.[1] It was reported that Tat protein can penetrate both the outer membrane of cells and the membrane of nucleus. A comparative research of Tat derived peptide and polyarginine demonstrates that arginine residues play an important role in TAT protein penetrating cell membrane. [2]
Telomerase is a new target of cancer therapy. Relative studies demonstrate that over 80 percent primary cancer cells have the higher telomerase activities comparing to the normal cells. The higher activities of telomerase may relate to the maintenance of the reproductive ability of the cancer cells. Hence the inhibitors of telomerase play an important part in the research of the biological function of telomere and telomerase.Telomerase inhibitor may be developed into a new kind of anticancer agents. Telomerase consists of RNA template and enzyme protein, so the antisense oligonucleotide targeting to its RNA template can effectively inhibit the activity of telomerase invitro. Some antisense sequences targeting to telomerase’s mRNA were suggested by Sheng-qi Wang. TRAP-PCR analysis and the result of Weston-blot showed that one of the sequences dramatically inhibits the activity of telomerase at micromole concentration.
RESULT AND DISCUSSION
- The peptide and oligonucletide sequences
The antisense sequence targeting to mRNA of the telomerse protein is ACTCACTCAGGCCTCAGACT, and the antisense sequence targeting to the RNA template is CTCAGTTAGGGTTAGACAA.
Considering the excellent transmembrane activity, we designed the argnine-rich peptide sequence and investigated the synthetic conditions for the coupling reaction between the argnine-rich peptide and ODN. The designed peptide sequences are as follows:
ArgArgArgArgArgArgCys, （R6C）
ArgArgArgArgArgArgArgArgArgCys, （R9C）
D-ArgD-ArgD-ArgD-ArgD-ArgD-ArgD-ArgD-ArgCys, （D-R9C）
ArgLysLysArgArgGlnArgArgArgCys(Tat peptide), （TAT）
2. The synthetic strategy
As mentioned above, although scientists have undergone so many meaningful exploration of the synthesis of the antisense oligonucleotide, thereis not a general method for the synthesis of peptide-oligonucleotide conjugate. There are several methods for the synthesis of the argnine-rich peptide- oligonucleotide conjugates [4,7-9].Generally, -SH group is used in the peptide sequence and linked with the ODN activated by maleimido or haloacetyl functions, or the –SH reacts with the oligonucleotide containing –SH toform the conjugate linkedby -S-S-. Robles used Fmoc to protect the guanidine group of arginine and applied to synthesize the arginine-rich peptide-oligonucletide conjugate by in-line synthesis. However, when we used a double-Fmoc-protected arginine for the synthesis of the designed conjugate, we only got a complicated product. Hence, we chose to use disulfide to link the ODN and the peptide.This strategy can avoid the incompatibility of peptide chemistry and oligonucleotide chemistry in the conjugate synthesis, on the other hand, the disulfide linkage can be reduced afterentering the cellsand release the antisense
oligonucleotide to hybridize with complementary target.
Fig.1 Fmoc strategy of synthesizing peptide in solid phase
3. oligonucleotide synthesis
The method for the synthesis of oligonucleotide was standard phosphoramidite chemistry and the block containing –S-S- functional group was coupled during the last step of the synthesis. After the –S-S- of ODN (I) wasreducedwith DTT, the mixture was purified by HPLC, and the oligonucleotide containing free –SH reacted with dithiodipyridine toform oligonucleotide (II) with the terminal sulfhlydral group. In order to investigate the penetrating activity of the designed conjugate, we also synthesized the 3’-FITC-5’-S-S-ODN (III). The 3’-amino compound (II) could react with fluorescence isothiocyanate(FITC) to produce 3’-FITC-5’-S-S-ODN (III). The resultant product was conjugated with the peptide to produce the fluorescence-labeled conjugate (IV).(Fig.2, Fig.3)
Fig.2 the synthesis of 3’-amido-5’-sulfhydryl-ODN
4.peptide synthesis
PAL resin was used as the solid carrier and Fmoc method was adopted during the synthesis of peptide. The condensation reaction was carried out using the rapid in situ neutralization method. All the protected amino acids used in the experiment were Fmoc-Arg(pbf)COOH, Fmoc-Gln(Trt)COOH, Fmoc-D-Arg-(Pbf)COOH, Fmoc-Lys(Boc)COOH, Fmoc-Cys(Trt)COOH.A Cys was introduced at the end of the C-end of peptide, the –SH of Cys could be linked with the –SH of the ODN, and the peptide was cleaved from the resin, meanwhile the peptide was deprotected (Fig.1).
Fig.3 the synthesis of 3’-FITC-5’- sulfhydryl–ODN
The synthesis of arginine-rich peptide:
The peptide assembly was performed in a home-made manual synthesizer. (Fig.4 shows the home-made manual synthesizer). This special reactor was made from 5ml PVC injector. 2.5 mole equivalent of amino acid was added into DMF containing 2.5 Mole equivalent of HBTU/HOBt, the amino acidwas activated for 2 minutes after DIEA was added, then the activated amino acid was added into the reactor, the solution was collected to stay at room temperature for an hour. A little resin was sampled to detect if the reaction was completed by ninhydrin test. Ifthe ninhydrin test was negative, the resin was washed with DMF,and Ac2O:DIEA:DMF(1:1:2) were used to cap the unreacted residual amino group. DMF containing 20%piperidine was used to deprotect the Fmoc, and the next amino acid was linked. After the last amino acid was linked, DMF containing 20% piperidine was used to deprotect the Fmoc, then DMF, DCM were used to wash the resin, and the resin was dried in vacuo for the next step.
To find a method which is suitable for the cleavage and the deprotection of the arginine-rich peptide,we explored two prescriptions for the procedure according to some reference [11].
Prescription1: TFA:H2O: phenol:TIS:EDT:anisole (88:4:2:2:2:2) (reagent A)
Prescription2: TFA:H2O: phenol: thioanisole :EDT (82.5:5:5:5:2.5) (reagent B)
The amount of the reagent A or Bwas 150μl/10mg resin, and the time of the reaction was 10 hours. 1 ml water was used to quash the reaction, the aqueous phase was washed 3 times by cold t-BuOMe, and the organic phase was separated carefully. The aqueous phase was concentrated and purified by HPLConaDelat PAK C18 column, (100Å, 7.8×300mm). Samples were monitored at UV 225 nm.The purified peptides were lyophilized and kept in -20℃. When the cleavage was carried out by reagent A, there was a peak of an impurity, and its molecule weight was that of MW (peptide) + EDT(shown by MAIDI-TOF MS ). So we chose reagent B.Fig. 5 shows the results.
1 2
3 4
Fig.5 semi-preparative HPLC chart of the arginine-rich peptide (the amount of the injection is 1.5 ml, Delta PAK) 1,2,3,4 are respectively the semi- preparative HPLC charts of R6C, R9C, D-R9C, TAT; See the condition of HPLC at the experiment section.
The four sequences of the peptide (R6C, R9C, D-R9C, TAT)were designed, synthesized and purified by the HPLC using the methods mentioned above. The result of the MALDI-TOF MS showed that the molecule weights of the designed peptideswere inaccordance totheir theoretical molecule weights. The amino acid analysis of TAT derived peptide showed that Arg:Lys:Gln:Cys=6.1:2.0:1.2:0.7 (the theoretical result is 6:2:1:1).
5.on-resin fragment coupling of arginine-rich peptide and oligonucleotide
In order to link the peptide with ODN by the disulfide bond, we must modify the oligonucleotide by introducing –SH group. The syntheses of oligonucleotide containing–SH groupand fluorescence-labeled peptide-oligonucleotide are shown in Fig.2&3. The solid support used in the syntheses was CPG and the di-functional oligonucleotide was synthesized by the standard phosphoramidite method. C6SSC6ODMTwas introduced by the standard method at the last step. The efficiency of each single step was above 95%.
Astriab-Fisher and his partners [12] used 3’-end labeled and 5’-end –SH activated ODN to react with the 3 time TAT derived peptide in 0.3M KBr, 0.002M K2HPO4 (pH7.5), 5M CO(NH2) 2, and separated the product with ion-exchange column, they got the fluorescence-labeled peptide-oligonucleotide conjugate NH2RKKRRQRRRPPQC(COOH)-SS-5`-TCCCGACCTCGCGCTCC-3`-TAMAR. Vives studied the synthesis of the basic-peptide oligonucleotide conjugate by fragment condensation. In order to solve the problem of precipitation during the synthesis, the author dissolved the fluorescence-labeled conjugate into H2O containing KCl and CH3CN, and the final concentration of KCl was 0.4M, the concentration of CH3CN was 40%(v/v). [13] After the reaction, the product was separated and purified by DEAE ion-exchangeHPLC column, and the desired molecule was obtained. Wei and his partners [14] synthesized the conjugate of 9 mer ODN and poly arginine R7, and the conjugate of R7 and two pieces of 9 mer ODN (linked by -S-S-); the reaction was performed in 0.1M NaHCO3 solution, and the yieldwas 50%. Recently, it was reported that the synthesis of the conjugate of R7 and 18 mer ODN linked by hydrazone, the reaction was performed in the citric acid buffer solution (pH5.3), the time of the reaction was 20 hours, and the purification yield was 47%.
When we synthesized the conjugate, we tried all of the methods mentioned above; however, we didn’t get the desired conjugate because of the problem of the precipitation formed by oligonucleotide and poly arginine during the reaction. The increase of the concentration of CH3CN and the salt did not prevent the occurrence of the precipitation. The precipitation couldn’t dissolve in H2O, DMF, and the mixture of H2O and CH3CN. Considering the strong electrostatic interaction between one peptide molecule with two or even more oligonucleotides,Fmoc-Tat-C-SHorFmoc-R9-C-SH reacted with the 5’-end activated antisense oligonucleotide. We got the desired molecule in 0.4M KCl, 40% CH3CN solution. The peptide-oligonucleotide conjugate was purified by the HPLC, ESI-TOF MS showed the detected molecule weight was identical with the theoretical value.
Table.1 the molecule weight of the conjugate of ODN and
Fmoc protected peptide
Compounds / Theoretical Molecule weight / Detected Molecule weightFmoc-Tat-C-SH / 1662.78 / 1665.20
Fmoc-R9-C-SH / 1747.20 / 1746.85
Fmoc-Tat-C-SS-ODN / 7917.78 / 7896.93
Fmoc-R9-C-SS-ODN / 8002.20 / 7989.79
The sequence of the ODN is CTCAGTTAGGGTTAGACAA.
Fig.6 The synthesis of the conjugate
Fig.7 the results of the fragment condensation reaction (anion-exchange HPLC, SOURCETM)
Left:D-R9C reacted with the ODN on the solid support for 2 hours, thelater peak was the original ODN’s, the earlier one was the conjugate’s. Right: D-R9C reacted with the ODN on the solid support for 8 hours, and the peak of the original ODN was small
The interaction between arginine and oligonucleotide in solution can be avoided if the solid phase stepwise synthesis is adopted. Although some scientists have tried to synthesize this kind of conjugate by the traditional solid phase synthesis, only a low yieldwas obtained and the product was complicated because of the incompatibility of the protecting group. We tried to absorb the oligonucleotide to the weak anion exchange resin, so part of negative charges on the ODN could be offset.The anion-exchange resin absorbing oligonucleotide was used for the synthesis of the conjugate of oligonucleotide and rich-arginine peptide. (Fig 6)
An aliquot of purified oligonucleotide with pyridine sulfenyl-activated thiol function (10 OD) was dissolved in water ,then the solution was absorbed on 0.5ml of anion-exchange resin (SOURCE,AMERSHAM PHARMACIA) contained in a column (diameter 4mm). Before addition of the peptide, the availability of the cysteine residue sulfhydryl group was determined by its absorbance at 412nm after reaction with 2-4,dithio(bis)nitrobenzioc acid, and the column was flushed by nitrogen. About threefold equivlent peptide dissolved in 20mM phosphate buffer (pH7.0) was added to the column. Eight hours later, the column was washed with water. The molecules absorbed on the resin was eluted out by 1M NaCl. The collected solution is desalted through oligonucleotide purification cartridge(OPC) and purified by HPLC using a DEAE column(column 8×100mm,resin: SOURCE) with a linear gradient from 0-80% in 30min of 1M NaCl in water and recorded at 260nm. After desalting through OPC, the conjugate was dried in Speed-Vac(yield 50%). The conjugate is further identified by ESI-TOF MS [Table 2, three peptides are used in the conjugation, these are: (D-Arg)9-Cys, (Arg)9-Cys, (Arg)6-Cys].
Table.2 the reservation time and the molecule weight of the conjugate condensed through the ON-RESIN
Substance / ODN / D-R9C-ODN / R9C-ODN / R6C-ODNThe reservation timeof HPLC / 33.5 min / 28.27min / 28.37min / 29.51min
Molecule weight / Theoretically / 7782.06 / 7782.06 / 7313.50
Actually / 7780.50 / 7780.00 / 7311.00
6.transmembrane activity of peptide conjugated oligonucleotide
We investigated the transmembrane activity of arginine-rich peptide conjugated oligonucleotide targeting to telomerase mRNA in HepG2 cells. The fluorescence could be found in HepG2 cells under confocal microscope after incubation of the labeled antisense oligonucleotide conjugate (IV) with HepG2 cells for 5hr. (Fig 8) Further investigation is to be continued.
EXPERIMENT AND METHODS
(I)General method
- The treatment of the solvent, raw material and the reagent
All the solvent, raw material and reagent are analytical or chemical purity. CH3CN and MeOH, used as the mobile phase of the HPLC, were of HPLC grade purity, the water used was the re-distilled water, and the reagent was treated by the normal method.
- Instrument and Method
GF254 silica gel, 200 and 300 mesh, was used for chromatographic column , and the silica gel H was produced by Qingdao oceanic chemical factory; TLC was detected by UV-detector at the wavelength of 254nm, MS was performed withFAB, MALDI－TOF, ESI-TOF MS(VG－ZAB－HS, Bruker APEXTMII, Bruker Reflex3, and Micromass ESI-MS-MS Q-TOF2). NMR was performed with Varian VXR-500, JEOL AL300, Bruker Advance300. HPLC was performed with Gilson HPLC, and the chromatographic columns are Delta PAKC18(7.8×300), Nucleosil C18(4.6×250).
Fig. 8.1 Fluorescence micrographs of HpeG2 cells treated with R9C-oligonucleotide-FITC conjugate
Fig. 8.2 Control (without conjugate)
- The method of the HPLC purification and analysis
Purification of the peptide:
Chromatographic column: Delta PAK C18, 7.8×300mm, 100Å.
The HPLC gradient: 0-80%B/0-30min, pump A was 0.08% TFA/H2O, pump B was 0.08% TFA/ CH3CN,
Flow: 3ml/min
Purification of the peptide-oligonucleotide conjugate:Delta-PAK C18column, Waters,100Å,15μm,7.8×300mm, gradient elution, 0－40％B/0-25min,40-100%B/25-40min, the mobile phase in pump A was 0.1M TEAA, pH7.0, in pump B was CH3CN, and the flow rate was 3ml/min.
Analysis of the peptide-oligonucleotide conjugate:Nucleosil C18 column,
Phenomenex,100Å,10μm,4.6×250mm, the gradient was 0－40％B/0-25min,
40-100%B/25-40min, the mobile phase in pump A was 20mMTEAA, in pump B wa
50% CH3CN, and the flow was 1ml/min.
Purification of the oligonucleotide:DEAE anion-exchange column 6×100 mm，the
solid phase was the SOURCE made by Pharmacia Company, the gradient was 0－
80%B/0-40 min,mobile phase A was20mM phosphate buffer solution, pH 7.0,
mobile phase B was 20mM phosphate buffer solution (pH 7.0)containing2M NaCl.
(II)synthesis of arginine-rich peptide conjugated oligonucleotide
The fragment condensation method of the conjugate of the peptide and the antisense oligonucleotide:
- The synthesis of the peptide
PAL resin (0.11mmol/g) and Fmoc-L-amino acids were purchased from Advanced Chemtech. Rapid in situ neutralization protocols based on Fmoc/HBTU/HOBt/DIPEA chemistry were used in the peptide synthesis. The Fmoc amino acid derivatives were: Fmoc-L-Arg(Pbf), Fmoc-D-Arg(Pbf), Fmoc-Cys(Trt). The peptide synthesis was carried out in a home-made manual synthesizer. Fmoc-amino acid were used in 2.5 mol equiv and activated with 2.5 mol equiv of HOBt, 2.5 mol equiv of HBTU and 3 mol equiv of DIPEA in DMF for 3 min, followed by a 1 hr coupling. Fmoc deprotection was performed in 20% piperidine in DMF. Cleavage and side chain deprotection involved treating the peptide with a mixture containing 82.5%TFA, 5% thioanisole, 5% phenol, 5% water and 2.5% ethylene disulfhydrate overnight at room temperature under shaking. After the solid support was filtered, cold methyl t-butyl ether was added to the filtrate. The precipitated peptide was purified by HPLC, which was carried out using a Waters column (7.8×300mm). Samples were monitored at 225nm .The gradient was 0-80% B in 30 min. Mobile phase A was 0.1% TFA in water and mobile phase B was 0.1% TFA in acetonitrile. The purified peptides were lyophilized and kept in -20℃.
The synthesis of the oligonucleotide:
The synthesis of the 5’-SH oligonucleotide: The phosporothioate oligonucleotide 5`-ACT CAC TCA GGC CTC AGA CT-3`-DMT tagerting to the RNA template of the telomerase was synthesized with the Expedite 8909 DNA synthesizer by the standard phosporamiditechemistry. After the last DMT was cleaved and deprotected, phosporamiditeof DMT-protected bis-(6-hydroxyhexyl disufide) was linked. The oxidizing agent in the reaction was 0.02M I2. When the synthesis is over, the solid supporter was filtered and the filtrate was dry in Vac Speed. The dried residue was applied to HPLC. The collected portion of purified oligonucleotide was concentrated and dried in vacuo. The dry powder of oligonucleotide was kept at the temperature of -20℃for the next step.