Hartweck Supplement 1
A focal domain of extreme demethylationwithin D4Z4 in FSHD2
Lynn M. Hartweck, PhD; Lindsey J. Anderson;Richard J. Lemmers, PhD; AbhijitDandapat, PhD;Erik A. Toso, MSc; JolineC. Dalton, MS, CGC; RabiTawil, MD;John W. Day, MD, PhD; Silvère M. van der Maarel, PhD; MichaelKyba, PhD
Author for correspondence:
Michael Kyba, Lillehei Heart Institute, 4-126 Hasselmo Hall, 312 Church St. SE, Minneapolis MN 55455, Phone 612-626-5869, fax 612-624-8118,
e-Methods:
Converted DNA was amplified using primer setse1DR1Fe2: GAAGGTAGGGAGGAAAAG; DR1R: ACTCAACCTAAAAATATACAATCT (fragment length 251bp with 29 CpGs; located 563-814 bp from the Kpn I site at the start of D4Z4); designed with MethPrimere1:DR2F: AAATATGTAGGGAAGGGTGTAAGTT; DR2R: CTTAAATATACCAAACCCTCTCTCC(fragment length 276bp,with 22 CpGs; located 998-1271 bp from the Kpn I site at the start of D4Z4); DR3F: GTAGAGGGGATTTTTTAATTTGTTT; DR3R: CAAACACCCCTTAACCCTAC(fragment length 222bp, with 23 CpGs; located 2472-2794 bp from the Kpn I site at the start of D4Z4). With the exception of DR1R e2, primers were designed to regions that did not contain CpG sites and therefore would amplify methylated and unmethylated sequences after bisulfite conversion equally well e1. DR1R covers a single unmethylatedCpG, but later analysis indicated that this primer was able to prime DNA regardless of the original methylation status (Figure e-2). Amplification was carried out using Takara ExTaq (Qiagen, Valencia, CA) according to manufacturers' instructions with cycling parameters: Denature: 94C one minute, Cycle: 94C 10 sec, 54C 15 sec, 72C 20 sec, for 30 cycles; Final extension at 72C 5 minutes. PCR products were purified from 2% agarose gels with Wizard SVgel and PCR Purification system (Promega, Madison, WI) and cloned with the TOPO T/A cloning kit (Invitrogen). Randomly selected colonies were grown overnight at 37C with antibiotic selection, and DNA was isolated with miniprep kits (Qiagen, Valencia, CA). At least ten randomly cloned PCR products for each sample and region were sequenced and analysed and the average number of methylated CpGs per total number of CpGs (methylated and nonmethylated) that were sequenced for each set are listed. Only CpGs with respect to the reference sequence where examined. We choose clones with a conversion frequency of greater than 95%. DNA was sequenced at the Iowa State DNA sequencing center (Ames, IA) with standard primers. Sequences were analyzed, and figures were generated with Bisma software e3. Average methylation scores were calculated as the total number of methylated Cs among the total number of methylated and unmethylated Cs (for all cloned PCR products for a particular sample N=10 to 15) within CGs that were part of a CG dinucleotide in the reference sequence. Nucleotides that were neither C nor T were not included in the total. Means comparisons were done with ANOVA using SAS JMP software (Cary, NC). Methylation figures were generated using the Boxshade program available through the SDSC Biology Workbench website e4. DR3 sequences gave us a higher percentage of polymorphisms within the amplified region. To determine that these were actual polymorphisms, we amplified the DR3 region from non-converted DNA using non-converted versions of DR3F (GTCACCCTGCTCCCTCGTG) and non-converted DR3R (CACCACGGACTCCCCTGGGACGT) primers and products were sequenced (Figure e-1).
Supplemental Figure legends:
Figure e-1. The DR3 region has DNA polymorphisms that contribute to differences in bisulfite CpG sequence analysis for methylation. The DR3 region was sequenced from DNA without conversion and nineteen clones were sequenced and aligned. Below the alignment is the consensus sequence of the nineteen clones and below that is the reference sequence for DR3 (from AF117653) with each CpG numbered sequentially. e4
Figure e-2. Primers for the DR1 site are not biased by methylation. DNA from bisufite treated DNA samples estimated to be completely methylated (98%) or nonmethlated (2%) were mixed equally and PCR products were generated, cloned and sequenced. Fourteen clones were sequenced and estimated to have 99% conversion efficiency and 36% methylation, which is not different than the hypothesis of 50% methylation using Chi square (p=0.063) to test the hypothesise5, e6.
Table e-1
Identification of samples used in this study by tissue, bisulfite coversion efficiency, sex, age at draw or biopsy, and genotype information including, array size, haplotype and SSLP for each allele of chromosome 4 and 10. Myoblast samples are listed at passage number since biopsy.
e-References:
e1.Li LC, Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics 2002;18:1427-1431.
e2.Katargin AN, Pavlova LS, Kisseljov FL, Kisseljova NP. Hypermethylation of genomic 3.3-kb repeats is frequent event in HPV-positive cervical cancer. BMC Med Genomics 2009;2:30.
e3.Rohde C, Zhang Y, Reinhardt R, Jeltsch A. BISMA--fast and accurate bisulfite sequencing data analysis of individual clones from unique and repetitive sequences. BMC Bioinformatics 2010;11:230.
e4.Subramaniam S. The Biology Workbench--a seamless database and analysis environment for the biologist. Proteins 1998;32:1-2.
e5.Lowry R. VassarStats: Website for Statistical Computation [online]. Available at:
e6.Snedecor GW, Cochran WG. Statistical Methods, Seventh ed. Ames, IA: The Iowa State University Press, 1980.
Page | 1