Oligo name / Properties
Mutant-Specific Primer / 1. The forward primer
2. 3’-end anchored to the variant-base
3. TM is at least 15°C below PCR extension temperature
Blocker Oligo / 1. Amplify the same DNA strand as mutant-specific primer
2. Complementary to wild-type sequence
3. Variant-base at approximately in middle of oligonucleotide
4. Not extendable by polymerases (phosphorylated on 3’-end)
5. TM is about 4 °C higher than TM of mutant specific primer, but not greater than, 60°C
The unique features and considerations when designing the mutant-specific forward primer and blocker oligo are described.
Supplemental Table 2: Primer Sequences
Oligo name / Sequence / Calculated TM (oC)
Mutant-Specific Forward Primer 1 / CAAAAGCCGCTCGCAT / 53.9
Mutant-Specific Forward Primer 2 / TACAAAAGCCGCTCGCAT / 55.1
Mutant-Specific Forward Primer 3 / CTACAAAAGCCGCTCGCAT / 56.0
Mutant-Specific Forward Primer 4 / GCTACAAAAGCCGCTCGCAT / 58.8
Blocker Oligo / CGCTCGCAAGAGTGCGC / 59.8
Wild-Type Forward Primer / GCTACAAAAGCCGCTCGCAA / 60.5
Reverse Primer 1 / TTCACGGAGCGCCACAGTA / 59.5
Reverse Primer 2 / TCTGGAAGCGCAGATCTGTT / 58.4
The sequences and melting temperatures of oligos used in the experiment are described. The Tm was calculated using Primer 3.
Supplemental Figure 1: The amplification selectivity of H3F3A K27M mutant allele using cDNA library is further enhanced with increased concentration of blocker oligos.
Supplemental Figure 2: DIPG2 contains low levels of H3F3A K27M. (a) H3F3A K27M mutation in DIPG2 was detected using H3F3A cDNA isolated from DIPG2 cDNA library. The PCR procedure failed to detect H3F3A K27M mutation in DIPG2 sample obtained from Dr. Baker’s laboratory when cDNA library was used as template (Figure 5c). We then amplified H3F3A cDNA using DIPG2 cDNA library. The amplified H3F3A cDNA was used as the template for analysis H3F3A K27M mutation as described in Fig. 1-3. (b). The Sanger sequencing of H3F3A cDNA barely detects H3F3A K27M mutation.