Name______Date ______
South Lewis High School – Mr. Comet
Living Environment
Unit 4 Note Packet
Student Name______
Date Packet Began______Date Packet Finished______
Lab # / Title / Turned in?Yes No
Yes No
Yes No
Yes No
Yes No
Yes No
Yes No
Yes No
Homework assigned / Quizzes Scheduled / Tests Scheduled / Other Assignments
Mendelian Genetics
Upon completion of this unit the student will:
q recognize that Mendel developed his laws of heredity without any prior
knowledge concerning genes or chromosomes.
q list at least five reasons for Mendel's success working with pea plants.
q recognize that every organism has coded instructions for specifying its traits and
that DNA provides a reliable way for transferring hereditary information from one
generation to the next.
q recognize that each gene carries a separate piece of information.
q recognize that the inherited trait of an individual can be determined by one or by many genes, and that one gene can influence more than one cell.
q recognize that each human cell contains thousands of genes.
q correctly define the following terms; gene, allele, chromosome, locus, and homologous chromosomes.
q recognize that alleles are located on the same position on homologous chromosomes.
q recognize that in asexually reproducing organisms, all the genes come from a single parent and are identical to those of the parent.
q recognize that sexually reproducing organisms receive half their genetic information from their Mother's egg and half from their Father's sperm.
q recognize that sexually reproduced offspring usually resemble, but are not identical to their parents.
q define the following terms and correctly use them in reference to genetic crosses;
homozygous, heterozygous (hybrid), parental generation, first filial generation, and second filial generation.
q define the terms progeny and sibling.
q define the following terms and correctly use them in reference to genetic crosses;
phenotype and genotype.
q state Mendel's three Laws of Heredity and correctly explain each.
q list two examples of intermediate inheritance.
q list two examples of codominance.
q correctly complete genetic crosses/Punnett squares involving the Law of Dominance, incomplete dominance, or codominance.
q define the term gene linkage and list an example of this in humans.
q define the term crossing over and explain how it leads to genetic variability in
sexually produced offspring.
q explain what is meant by a karyotype and list some examples of its usefulness.
q explain how sex is determined in the genetic makeup of humans.
q explain why the male determines the sex of a human baby.
q define the term mutation.
q explain why only mutations in gametes may be passed on to the offspring.
q explain the difference between a chromosomal alteration and a gene mutation.
q define the following terms correctly; disjunction, nondisjunction, polyploidy,
and mutagenic agent.
q list some examples of mutagenic agents.
q recognize that the adaptive value of a gene mutation is dependent upon the nature of the mutation and the type of environment in which the organism interacts.
q list three examples of the interaction of the environment with genes in the expression of inherited traits.
q explain the difference between the following types of selective breeding; artificial selection, inbreeding, hybridization, vegetative propagation, and recombinant DNA technology.
q explain the difference between the following changes in chromosome structure;
translocation, addition, deletion, and inversion.
q recognize that the mapping of the genetic instructions in cells makes it possible to detect, and perhaps correct, defective genes that lead to poor health.
q recognize that substances from genetically engineered organisms may reduce the costs and side effects of replacing costly body chemicals.
I. Basic Genetics -- Mendel (1866)
** Mendel developed some basic principles of heredity
Image from: http://www.jic.bbsrc.ac.uk/germplas/pisum/zgs4f1.gif
Reginald Punnett
Image from: http://www.naturalselectionreptiles.com/Genetics.html
** As a result of analyzing specific mathematical ratios associated with certain characteristics in the offspring, Mendel proposed that characteristics were inherited
as the result of the transmission of hereditary factors.
A. . Why was Mendel successful with the pea?
1.
2.
3.
4.
5.
Image from: http://eebweb.arizona.edu/courses/ecol320/Mendel'sPeaSoupSmall.jpg
B. Mendel had no knowledge of genes or chromosomes
8. genes:
•Every organism requires a set of coded instructions for specifying its traits. For offspring to resemble their parents, their must be a reliable way to transfer hereditary information from one generation to the next.
•Each gene carries a separate piece of information. An inherited trait of an individual can be determined by one or by many genes, and a single gene can influence
more than one cell.
•Each human cell contains thousands of different genes.
9. alleles:
Image from: http://www.naturalselectionreptiles.com/Genetics/allele.jpg
3. chromosomes:
4. locus:
(a.) homologous chromosomes:
Image from: http://www.biology.iupui.edu/biocourses/N100H/ch10genetics.html
** Alleles are located in the same position or locus on homologous chromosomes.
C
A. Sexually reproducing organisms normally receive half their genetic information from the Mother's egg and half their genetic information from their Father's sperm.
E. The significance of Mendel's work was not immediately recognized.
F. Mendel's hereditary factors, now called genes, exist at definite loci in a
linear fashion on chromosomes. Two genes associated with a specific characteristic are known as alleles and are located on homologous chromosomes. The gene-chromosome theory provides the mechanism to account for the hereditary patterns which Mendel observed.
A. homozygous (pure)
B. heterozygous: (hybrid)
3. parental generation (P
4. first filial generation
A. second filial generation
II. Some Major Genetic Concepts
Image from:
A. Law of Dominance (Mendel)
Image from: http://biology.about.com/library/weekly/aa100903a.htm
1.
2.
ex. red flowering X white flowering-->red flowering peas
3. dominant trait
4. recessive trait
5. progeny
6. siblings
7. Punnett square
8. genotype
9. phenotype
B. Principle of Segregation and Recombination (Mendel)
Image from: http://biology.about.com/library/weekly/aa100903a.htm
1.
2. As a result of fertilization, ______. As a consequence, new allelic gene combinations are likely to be produced.
** Segregation and recombination is illustrated by the cross between two individuals heterozygous for a trait.
C. Law of Independent Assortment (Mendel)
Image from: Image from: http://biology.about.com/library/weekly/aa100903a.htm
1. If the genes for two different traits are located on different chromosomes (nonhomologous chromosomes), they segregate randomly during meiosis and, therefore, may be inherited independently of each other.
2. The cross of two organisms heterozygous for a trait is known as a hybrid cross.
** Assuming large numbers of such crosses, the phenotypic ratio of dominant
offspring to recessive offspring is 3:1 and the genotypic ratio of homozygous dominant offspring to heterozygous dominant offspring to homozygous recessive offspring is 1:2:1
D. Intermediate Inheritance
•2 examples -- incomplete dominance and codominance
a. Incomplete Dominance - A case of contrasting alleles in which one allele is only partially dominant over the other --the dominant allele is only partially expressed when the recessive
allele is present. Sometimes called blending inheritance
examples: red snapdragon X white snapdragon ----> pink snapdragons
Image from: http://www.naturalselectionreptiles.com/Genetics/exIncompleteDominance.jpg
b. Codominance:
Image from: http://www.naturalselectionreptiles.com/Genetics/exCodominance.jpg
ex. cross between red and white horses gives roan horse
ex. cross between black and white Andulusian fowl gives blue (gray) fowl
** Examples of codominance in humans are the blood groups and the
sickle cell trait. (sickle cell anemia)
A Discussion of Blood Types in Humans……
Blood Type Phenotype Genotype
A (homozygous) Type A blood IAIA
A (heterozygous) Type A blood IAi
B (homozygous) Type B blood IBIB
B (heterozygous) Type B blood IBi
AB (A&B heterozygous) Type AB blood IAIB
O (homozygous) Type O blood ii
gene linkage
Linked genes are usually inherited together.
crossing over:
** Crossing over results in the rearrangement of linked genes and increases the variability of offspring.
Note in the picture above the four chromosomes make up a tetrad in synapsis. The second stage shows crossing over, and the last stage shows the genetic variability produced in the new gene combinations.
karyotype:
Image from: http://oak.cats.ohiou.edu/~schutte/kary.jpg
•Above is a karyotype of a normal human male.
•Human diploid cells contain ______chromosomes.
•autosomes:
•Homo sapiens has one pair of sex chromosomes - that which make us either male or female.
** In the male each sex chromosome is unlike and is designated XY. In the female each sex chromosome is alike and is designated XX.
** The sex of a human is genetically determined at fertilization when a sperm cell containing either an X or a Y chromosome unites with an egg cell containing an
X chromosome.
III. Mutations:
General statements about mutation….
** While an altered gene (mutation) may be passed on to every cell that develops from the mutated cell, only mutations in sex cells may be passed on to the
offspring.
** A mutation occurring only in body cells may be perpetuated in the individual but will not be passed on to the offspring by sexual reproduction.
•
•
B. Types of Chromosomal Alterations
3. Nondisjunction:
4. disjunction
** If disjunction fails to occur (nondisjunction), gametes with an addition or a missing chromosome will be produced.
3. Polyploidy
--
--
IV. Mutation: a random change in the chemical nature of the genetic material (DNA)
•
•
A. Mutagenic Agents -- increase the random incidence of mutations
1. Radiation
2. Chemicals --
** The adaptive value of a gene mutation is dependent upon the nature of the mutation and the type of environment with which the organism interacts.
** The environment interacts with genes in the development and expression of inherited traits.
1. Examples
• Many green plants contain chlorophyll for food making but if these leaves are
screened from the light they stop making chlorophyll.
• Identical twins raised in different environments may be vastly different in intelligence.
• If some white fur is shaved from a Himalayan rabbit and the area is kept cold with an ice pack, black fur will grow back in its place. (The gene for black fur is
active only at very low temperatures.)
Image from: http://www.ekcsk12.org/science/regbio/rabbit.gif
** The principles of genetics appear to hold true for all organisms including humans.
The acquisition of knowledge of human genetics has been limited because humans are not suitable subjects for experimentation. An increased knowledge of
human genetics has resulted from the expansion of the field of genetic counseling.
V. Types of Selective Breeding
A. Artificial Selection
--
B. Inbreeding
C. Hybridization
--
ex. English shorthorn cattle X Brahman cattle --->Santa Gertrudis cattle
(good beef X heat resistant -> good beef that is heat resistant )
D. Mutations may be preserved by vegetative propagation. (ex. seedless oranges)
E. Recombinant DNA (genetic engineering) ---
VI. Changes in Chromosome Structure
A. Translocation:
B. Addition:
C. Deletion:
D. Inversion
Knowledge of genetics is making possible new fields of health care. Mapping of genetic instructions in cells makes it possible to detect, and perhaps correct, defective genes that may lead to poor health.
Substances from genetically engineered organisms may reduce the cost and side effects of replacing missing body chemicals.
Modern Genetics
Upon completion of this unit the student will:
q recognize that DNA (deoxyribonucleic acid) controls cellular activity by influencing
the production of enzymes.
q describe the structure of a nucleotide.
q describe the structure of the DNA molecule.
q explain what is meant by complementary base pairing.
q explain how DNA is able to replicate itself during mitosis and meiosis.
correctly define the term template.
q explain the usefulness of the Watson-Crick model of DNA.
q define the term polymer and explain why DNA and RNA are polymers.
q describe the structure of RNA and list three ways it differs in structure from DNA.
q explain how proteins are synthesized from a DNA template.
q define the terms transcription and translation.
q explain the role of mRNA, rRNA, and tRNA in the process of protein synthesis.
correctly define the terms triplet, codon, and anticodon.
q in a paragraph or two, explain how DNA, RNA, and proteins are able to determine
the individuality of an organism.
q recognize that the work of a cell is carried out by the many different kinds of molecules it assembles (especially its proteins).
q recognize that proteins are long, folded molecules composed of up to 20 different kinds of amino acids which interact to produce specific protein shapes.
q recognize that enzymes and hormones are protein in nature.
q recognize that the specific shape of a protein usually determines its function.
q realize that offspring resemble their parents because they inherit similar genes that code for the production of proteins that form similar structures and perform similar functions.
q explain in a paragraph how cell functions are regulated.
q explain why the body cells of an organism can be very different from each other, even though they have the same genetic makeup.
q explain what is meant by cloning and list some uses of this.
q describe the process of genetic engineering and list five uses for this procedure.
q explain what restriction enzymes are and how they are used.
q recognize that inserting, deleting, or altering DNA segments can alter genes and that
this alteration may be passed on to every cell that develops from the altered cell.
q explain what the genetic mapping is.
q explain what the human genome project is and some potential advantages/ disadvantages of this work.
Image from: http://www.csiro.au/helix/dna/
Image from: http://www.msu.edu/course/isb/202/ebertmay/notes/snotes/02_15_07_genes_evo2.html
Chromosomes found in the nucleus carry the hereditary material -- DNA
What is DNA ?______
-
Structure of DNA Molecules
Image from: http://www.accessexcellence.com/RC/VL/GG/dna2.html
--DNA is a
--Nucleotide Unit is composed of
--The Nitrogenous Bases are:
A
T
C
G
What is a purine? …a pyrimidine?
Therefore, show the resulting base pairings below!
ATGCGCCCTACGTTAAAGCTTACGGGGTACCTAAGCCCTATTGCAAT
A Better Look at the Structural Sub-Units
Image from: http://www.accessexcellence.com/RC/VL/GG/basePair2.html
History of the Molecule